SARS-CoV-2 Nsp14 mediates the effects of viral infection on the host cell transcriptome
Curation statements for this article:-
Curated by eLife
Evaluation Summary:
The paper makes the provocative claim that SARS-CoV-2 Nsp14 is the key protein that mediates the effects of viral infection on the host cell transcriptome. The current evidence for this claim is good, but the paper would benefit from a few additional experiments. If confirmed by these experiments, the conclusion is unexpected and important, especially in these COVID times.
(This preprint has been reviewed by eLife. We include the public reviews from the reviewers here; the authors also receive private feedback with suggested changes to the manuscript. Reviewer #1 and Reviewer #2 agreed to share their name with the authors.)
This article has been Reviewed by the following groups
Listed in
- Evaluated articles (eLife)
- Evaluated articles (ScreenIT)
Abstract
Viral infection involves complex set of events orchestrated by multiple viral proteins. To identify functions of SARS-CoV-2 proteins, we performed transcriptomic analyses of cells expressing individual viral proteins. Expression of Nsp14, a protein involved in viral RNA replication, provoked a dramatic remodeling of the transcriptome that strongly resembled that observed following SARS-CoV-2 infection. Moreover, Nsp14 expression altered the splicing of more than 1000 genes and resulted in a dramatic increase in the number of circRNAs, which are linked to innate immunity. These effects were independent of the Nsp14 exonuclease activity and required the N7-guanine-methyltransferase domain of the protein. Activation of the NFkB pathway and increased expression of CXCL8 occurred early upon Nsp14 expression. We identified IMPDH2, which catalyzes the rate-limiting step of guanine nucleotides biosynthesis, as a key mediator of these effects. Nsp14 expression caused an increase in GTP cellular levels, and the effect of Nsp14 was strongly decreased in the presence of IMPDH2 inhibitors. Together, our data demonstrate an unknown role for Nsp14 with implications for therapy.
Article activity feed
-
-
Author Response
Reviewer #1 (Public Review):
Zaffagni et al. investigated the host cell response in a transcriptome level upon expression of viral proteins of SARS-CoV-2. They found that expression of Nsp14, highly conserved non-structural protein induces a dramatic remodeling of transcriptome that mimics SARS-CoV-2 infection. They revealed functional impacts of Nsp14 in various transcriptomic aspects such as transcript abundance, alternative splicing, and transcriptomic remodeling in a time course manner. They found IMPDH2, the rate-limiting enzyme in GTP biosynthesis as a key mediator of Nsp14 effects on host transcriptome, posing IMPDH2 and Nsp14 as a therapeutic target against SARS-CoV-2.
The paper revealed various transcriptomic effects upon Nsp14 expression. But biological relevance of infected cells should be verified on …
Author Response
Reviewer #1 (Public Review):
Zaffagni et al. investigated the host cell response in a transcriptome level upon expression of viral proteins of SARS-CoV-2. They found that expression of Nsp14, highly conserved non-structural protein induces a dramatic remodeling of transcriptome that mimics SARS-CoV-2 infection. They revealed functional impacts of Nsp14 in various transcriptomic aspects such as transcript abundance, alternative splicing, and transcriptomic remodeling in a time course manner. They found IMPDH2, the rate-limiting enzyme in GTP biosynthesis as a key mediator of Nsp14 effects on host transcriptome, posing IMPDH2 and Nsp14 as a therapeutic target against SARS-CoV-2.
The paper revealed various transcriptomic effects upon Nsp14 expression. But biological relevance of infected cells should be verified on these effects. It would be better to explain the mechanistic link among these observations and some data need to be further validated to support their conclusions.
- Are the alternative splicing pattern and increased circRNAs upon Nsp14 expression also observed in SARS-CoV-2 infection?
We thank the reviewers for the insightful question, helping us to contextualize our data to the physiological events of SARS-Cov-2 infection.
Regarding alternative splicing, previous publication showed that upon infection -90% of the genes show altered splicing events, mainly intron retention events (Banerjee et al. 2020). Previous studies attributed this to another viral protein, Nsp16, as expression of Nsp16 causes mRNA splicing suppression of a minigene by binding U1 and U2(Banerjee et al. 2020). However, those studies are mainly based on experiments in which Nsp16 is expressed as exogenous protein. Interestingly, we see a similar trend when we express Nsp14, with retention of more than 2,000 introns. This suggests that the massive intron retention observed during SARS-CoV-2 infection might be due to both Nsp16 and Nsp14. We have added some sentences contemplating this possibility although making clear that, while there is a known mechanisms by which Nsp16 expression provokes intron retention, this is not the case for Nsp14 and could be indirect (i.e., by activation of IMPDH2 since pharmacological inhibition of this protein partially rescues some intron retention effects, or other unknown pathway). Besides, we re-analyzed a published dataset of HEK293T-hACE2 infected with SARS-CoV-2(Sun et al. 2021) and we showed that there is a 10% overlap between the alternative splicing events in this dataset and in our dataset (in the HEK293T dataset a much smaller number of genes showed altered splicing upon infection). This is way over what is expected by chance (p-value <10-15), indicating that Nsp14 expression partially recapitulates the effects on alternative splicing that happen during the infection. Notably, this might be an underestimation because the sequencing depth of this published dataset was lower than our dataset. In any case, these effects in splicing strengthen the idea of parallel and comparable changes in gene expression during infection with those we observed upon Nsp14 overexpression.
Regarding circRNAs, previous studies showed that circRNAs are generally degraded in the context of viral infection (T.-C. Chen et al. 2020 and Liu et al. 2019), so it is no possible to perform this comparison as it will be masked by this general phenomenon. Nevertheless, we think that the Nsp14 effect on circRNAs expression is very interesting. Indeed, it could be related to the observed anti-innate immunity activity of Nsp14. One proposed model is that circRNAs can trap PKR into the cytoplasm, to repress its activity (Liu et al. 2019). Upon viral infection, they are degraded, and PKR can shuffle into the nucleus to trigger immune surveillance. Indeed, upon SARS-CoV-2 infection, circRNAs are mostly downregulated (our own unpublished data, manuscript in preparation), suggesting that maybe Nsp14 could antagonize innate immunity by upregulating some circRNAs. We agree we didn’t address this in the present study. In any case, we have now included all this explanation and discussion in the new version of the manuscript. We thank the reviewers for bringing this up, as it has significantly improved the manuscript.
- The authors showed that IMPDH2 contributes to Nsp14-mediated transcriptome changes. I wonder whether catalytic activity of IMPDH2 also affects the alternative splicing events mediated by Nsp14 expression. Given that the GC content is associated with the sensitivity to Nsp14-mediated alternative splicing, I am curious whether increased GTP level upon Nsp14 expression could be related to the alternative splicing events. How are the alternative splicing events when IMPDH2 inhibitor (MPA) was treated to Nsp14-expressed cells (comparing Nsp14+MPA to Nsp14+DMSO as Figure 6E)?
This is indeed an interesting point which we have now addressed experimentally. Unfortunately, we could not perform alternative splicing analysis on the original dataset generated for comparing Nsp14+MPA or Nsp14+DMSO because it is a 3’RNA seq experiment. To overcome this problem and address this point, we performed RT-qPCR for detecting some of the intron retention events observed upon Nsp14 expression. First, we confirmed that Nsp14 expression induces an increase in these intron retention events (Figure 6G and Figure 6 - figure supplement 6G, red bars). Second, we showed that both MPA and MZR treatment partially rescue the splicing of these introns (see Figure 6G and Figure 6 - figure supplement 6G). Taken together, these data demonstrates that IMPDH2 mediates also the alternative splicing events induced about Nsp14 and the idea that this might be mediated by the increased GTP is indeed a compelling hypothesis. We thank the reviewer for bringing this point.
In addition, and as mentioned above, we see increased circRNAs levels upon Nsp14 expression, that might derive from increased back-splicing. In the original version of the manuscript, we showed that the expression of circRNAs is partially rescued upon MPA treatment, and we confirmed this result using another inhibitor (Mizoribine, abbreviated as MZR). Now we included these results in Figure 6 - figure supplement 2F. These data indicate that IMPDH2 is involved in modulating circRNAs expression, probably due to biosynthesis regulation, but we cannot exclude that IMPDH2, or other pathways might increase also circRNA stability.
- It would be nice to provide information of a responsible domain of Nsp14 for its effect on the host transcriptome. Also, I wonder whether this domain is required for its interaction with IMPDH2, which would further validate the IMPDH2-mediated Nsp14 effect on host transcriptome.
We thank the reviewer for the insightful suggestion. In response to this comment, we generated a Nsp14 mutant for the N7-guanine–methyltransferase activity (Nsp14 D331A). Then, we compared how the expression of this construct affects some Nsp14 targets (mRNAs and circRNAs) by RT-qPCR (Figure 4G and 4H). Interestingly, we found that the N7-guanine-methyltransferase domain is required for mediating the gene expression changes induced by Nsp14 WT, as the level of the tested Nsp14-targets are not affected by expression of the N7-guanine-methyltransferase Nsp14 mutant. Importantly, we verified by Western Blot that the protein was expressed at levels comparable to WT Nsp14 (Figure 4 - figure supplement 2E). We thank the reviewer for suggesting checking more carefully which domain of Nsp14 is mediating the described effects. We believe that the information obtained with the N7-guanine-methyltransferase mutant provides a more comprehensive view of the mechanism. We agree with the reviewer that it would be nice in the future to check whether this domain is crucial for the interaction with IMPDH2 by performing CoIP or in vitro activity experiments.
- To make their conclusion "IMPDH2 is a key mediator of the effects of Nsp14 on the transcriptome of the hosting cell." more compelling, a rescue experiment using wild-type or catalytic dead mutant of IMPDH2 is needed. Or at least, the authors should confirm whether MPA effect on Nsp14-mediated transcriptome change can be reproducible using another IMPDH2 inhibitor.
We understand the concern of the reviewer and hence we have performed the suggested experiment and showed that the effect on mRNAs, circRNAs, and alternative splicing can also be partially reverted by using a second IMPDH2 inhibitor (Mizoribine - MZR). Specifically, MPA binds targets the site of the cofactor, NAD+/ NADH, while Mizoribine binds targets the binding pocket of the natural substrate, inosine monophosphate (IMP)(Liao et al. 2017). We presented the new data in the Figure 6 - figure supplement 2. We thank the reviewer for the suggestion that we believe significantly improved the manuscript.
-
Evaluation Summary:
The paper makes the provocative claim that SARS-CoV-2 Nsp14 is the key protein that mediates the effects of viral infection on the host cell transcriptome. The current evidence for this claim is good, but the paper would benefit from a few additional experiments. If confirmed by these experiments, the conclusion is unexpected and important, especially in these COVID times.
(This preprint has been reviewed by eLife. We include the public reviews from the reviewers here; the authors also receive private feedback with suggested changes to the manuscript. Reviewer #1 and Reviewer #2 agreed to share their name with the authors.)
-
Reviewer #1 (Public Review):
Zaffagni et al. investigated the host cell response in a transcriptome level upon expression of viral proteins of SARS-CoV-2. They found that expression of Nsp14, highly conserved non-structural protein induces a dramatic remodeling of transcriptome that mimics SARS-CoV-2 infection. They revealed functional impacts of Nsp14 in various transcriptomic aspects such as transcript abundance, alternative splicing, and transcriptomic remodeling in a time course manner. They found IMPDH2, the rate-limiting enzyme in GTP biosynthesis as a key mediator of Nsp14 effects on host transcriptome, posing IMPDH2 and Nsp14 as a therapeutic target against SARS-CoV-2.
The paper revealed various transcriptomic effects upon Nsp14 expression. But biological relevance of infected cells should be verified on these effects. It would …
Reviewer #1 (Public Review):
Zaffagni et al. investigated the host cell response in a transcriptome level upon expression of viral proteins of SARS-CoV-2. They found that expression of Nsp14, highly conserved non-structural protein induces a dramatic remodeling of transcriptome that mimics SARS-CoV-2 infection. They revealed functional impacts of Nsp14 in various transcriptomic aspects such as transcript abundance, alternative splicing, and transcriptomic remodeling in a time course manner. They found IMPDH2, the rate-limiting enzyme in GTP biosynthesis as a key mediator of Nsp14 effects on host transcriptome, posing IMPDH2 and Nsp14 as a therapeutic target against SARS-CoV-2.
The paper revealed various transcriptomic effects upon Nsp14 expression. But biological relevance of infected cells should be verified on these effects. It would be better to explain the mechanistic link among these observations and some data need to be further validated to support their conclusions.
1. Are the alternative splicing pattern and increased circRNAs upon Nsp14 expression also observed in SARS-CoV-2 infection?
2. The authors showed that IMPDH2 contributes to Nsp14-mediated transcriptome changes. I wonder whether catalytic activity of IMPDH2 also affects the alternative splicing events mediated by Nsp14 expression. Given that the GC content is associated with the sensitivity to Nsp14-mediated alternative splicing, I am curious whether increased GTP level upon Nsp14 expression could be related to the alternative splicing events. How are the alternative splicing events when IMPDH2 inhibitor (MPA) was treated to Nsp14-expressed cells (comparing Nsp14+MPA to Nsp14+DMSO as Figure 6E)?
3. It would be nice to provide information of a responsible domain of Nsp14 for its effect on the host transcriptome. Also, I wonder whether this domain is required for its interaction with IMPDH2, which would further validate the IMPDH2-mediated Nsp14 effect on host transcriptome.
4. To make their conclusion "IMPDH2 is a key mediator of the effects of Nsp14 on the transcriptome of the hosting cell." more compelling, a rescue experiment using wild-type or catalytic dead mutant of IMPDH2 is needed. Or at least, the authors should confirm whether MPA effect on Nsp14-mediated transcriptome change can be reproducible using another IMPDH2 inhibitor.
-
Reviewer #2 (Public Review):
The authors were interested in understanding the functional consequences, as read out by changes in the RNA levels of human cells, that each protein product of the SARS-CoV-2 genome produce. Overall the study achieves these goals through multiple deep sequencing assays and investigates the data generated deeply, considering multiple mechanistic possibilities to explain the genome-wide results. They additionally nicely provided more focused evidence for how their high throughput data can be narrowed to insights on the individual gene level, as was the case for the data exploring IMPDH2's role in Nsp14's cell remodeling abilities. Given the nature of the sequencing data, this study provides a useful resource for others to examine DEGs for Nsp14 as well as the other viral proteins. Further, and more broadly, …
Reviewer #2 (Public Review):
The authors were interested in understanding the functional consequences, as read out by changes in the RNA levels of human cells, that each protein product of the SARS-CoV-2 genome produce. Overall the study achieves these goals through multiple deep sequencing assays and investigates the data generated deeply, considering multiple mechanistic possibilities to explain the genome-wide results. They additionally nicely provided more focused evidence for how their high throughput data can be narrowed to insights on the individual gene level, as was the case for the data exploring IMPDH2's role in Nsp14's cell remodeling abilities. Given the nature of the sequencing data, this study provides a useful resource for others to examine DEGs for Nsp14 as well as the other viral proteins. Further, and more broadly, the work provides an interesting example of how a singular protein, in this case Nsp14, can have rapid and dramatic effects one the entire cell state; additional mechanistic work surrounding this ability could be of interest in the future.
Strengths of paper as submitted:
Broad scope of investigation for transcriptome changes across all known SARS-CoV-2 ORFs
Robust data on the dramatic impact that Nsp14 expression has on the transfected human cells
Correlation between individual-Nsp14 expression and changes during bonafide SARS-CoV-2 infections is strong
Mechanistic dissection to demonstrate a lack of import for the exonuclease domain in the observed transcriptome changes
Establishment of a function for the interaction between Nsp14 and IMPDH2, and some relevance for viral infection
Weaknesses of paper as submitted:
Lack of understanding of where the tagged proteins are expressed
Lack of understanding of the relative expression levels of each target
Lack of systematic understanding of how the viral proteins operate in concert (or even pair-wise) as they might during a native infection
-
SciScore for 10.1101/2021.07.02.450964: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics not detected. Sex as a biological variable not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Membranes were incubated with the following primary antibodies: mouse anti-Actin (Cell sig, 3700), rabbit anti-IMPDH2 (Proteintec, 12948-1-AP), mouse anti-Strep-tag (Quiagen, 34850). anti-Actinsuggested: Noneanti-IMPDH2suggested: (Proteintech Cat# 12948-1-AP, RRID:AB_2127351)anti-Strep-tag ( Quiagen , 34850suggested: NoneSecondary antibodies: rabbit anti mouse - HRP conjugated (Millipore), mouse anti rabbit-HRP conjugated (Millipore). anti mouse -suggested: Noneanti rabbit-HRP …SciScore for 10.1101/2021.07.02.450964: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics not detected. Sex as a biological variable not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Membranes were incubated with the following primary antibodies: mouse anti-Actin (Cell sig, 3700), rabbit anti-IMPDH2 (Proteintec, 12948-1-AP), mouse anti-Strep-tag (Quiagen, 34850). anti-Actinsuggested: Noneanti-IMPDH2suggested: (Proteintech Cat# 12948-1-AP, RRID:AB_2127351)anti-Strep-tag ( Quiagen , 34850suggested: NoneSecondary antibodies: rabbit anti mouse - HRP conjugated (Millipore), mouse anti rabbit-HRP conjugated (Millipore). anti mouse -suggested: Noneanti rabbit-HRP conjugated ( Millipore) .suggested: NoneExperimental Models: Cell Lines Sentences Resources HEK293T cell transcriptome was used as a reference to query for Enriched GO terms from up- and down-regulated DEG lists. HEK293Tsuggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)Recombinant DNA Sentences Resources Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon, Jang, et al., 2020) are listed in Table 14 and purified by Midi-prep using Invitrogen kit. pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Purosuggested: NoneBriefly, 1500ng of total DNA (1200 ng of pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Pur + 300ng of pLVX-EF1alpha-eGFP-2xStrep-IRES-Puro) were incubated at RT for 20 min with PEI, with a ratio 3:1=PEI:DNA in 100ul of serum free medium, and the mixture was added to the cells. pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Pursuggested: NonepLVX-EF1alpha-eGFP-2xStrep-IRES-Purosuggested: RRID:Addgene_141395)Cloning of Nsp14 ExoN mutants: pLXV-EIF1 alpha-2xStrep-SARS-CoV-2-nsp14-D90A/G92A-IRES-Puro: pLXV-EF1alpha-2xStrep-SARS-CoV-2-nsp14-IRES-Puro was opened with BsrGI-HF (NEB) and EcoRI-HF (NEB). pLXV-EIF1suggested: Nonealpha-2xStrep-SARS-CoV-2-nsp14-D90A/G92A-IRES-Purosuggested: NonepLXV-EF1alpha-2xStrep-SARS-CoV-2-nsp14-IRES-Purosuggested: RRID:Addgene_141380)Gblock: Gaattcgccgccaccatgtggtcccatccgcagtttgagaagggtggtggttcaggcggaggctccgggggcgggagctggtctcaccc gcaatttgaaaaaggcgctgcggctgctgaaaatgtaacgggcttgtttaaagactgtagtaaagtgatcacaggactccaccccacacaag cacctacccacctttccgtagatacgaagttcaaaacggaaggattgtgtgtggatataccagggataccaaaggatatgacgtaccgaagg ctgatttccatgatgggttttaagatgaattaccaagttaatggctaccccaacatgttcatcaccagggaggaggcaattagacacgtaagag cctggataggcttcGCCgttGCCggttgccatgcaacccgggaagccgtaggcacaaaccttccgttgcagcttggcttttccacgggc gtcaacctcgttgccgtaccgactggctatgttgacacgccgaacaacaccgatttctctcgcgtaagtgctaagcctcctccgggagatcaa ttcaagcatcttatacctctcatgtaca Primers: D90AG92A_F: cacacGaattcgccgccac D90AG92A _R: cacacTGTACATGAGAGGTATAAGA pLXV-EIF1 alpha-2xStrep-SARS-CoV-2-nsp14-D273A-IRES-Puro: pLXV-EF1alpha-2xStrep-SARS-CoV-2-nsp14-IRES-Puro was opened with BstBI (NEB) and AfeI (NEB). pLXV-EIF1 alpha-2xStrep-SARS-CoV-2-nsp14-D273A-IRES-Puro: pLXV-EF1alpha-2xStrep-SARS-CoV-2-nsp14-IRES-Purosuggested: NonePrimers: D273A_F: CCACACTTCGAACTTACTTCTATG D273A_R: cacacagcgctgcttttactacc Cloning of CXCL8-Firefly reporter: pGL_RSV_RF_BG (a modification of the pGL plasmid) was a kind gift from Dr. Marr at Brandeis University. pGLsuggested: RRID:Addgene_119952)Cells were transfected with 75ng of Firefly reporter, 75ng of Renilla reporter, and 600ng of pLVX-EF1alpha-SARS-CoV-2-Nsp14-2xStrep-IRES-Puro or 600ng of empty vector. pLVX-EF1alpha-SARS-CoV-2-Nsp14-2xStrep-IRES-Purosuggested: NoneAddgene plasmid # 49343; http://n2t.net/addgene:49343; RRID:Addgene_49343)(Wilson et al., 2013) 7xE-Box::Renilla was a gift from Koen Venken ( detected: RRID:Addgene_49343)Addgene plasmid # 124532; http://n2t.net/addgene:124532; RRID:Addgene_124532, Sarrion-Perdigones et al., 2020) At the indicated time point, cells were lysate in lysis buffer (25 mM Tris-phosphate at pH 7.8, 10% glycerol, 1% Triton X-100, 1 mg/ml of bovine serum albumin (BSA), 2 mM cyclohexylene diamin tetraacetate, and 2 mM DTT). detected: RRID:Addgene_124532)Software and Algorithms Sentences Resources , Gemini Bio/Fisher, # 100-602), and 1X Penicillin-Streptomycin (Penicillin-Streptomycin 100x, Genesee Scientific, 25-512) Gemini Bio/Fishersuggested: NoneBioinformatic analyses: Raw reads were aligned to the human genome (hg38) using STAR (Dobin et al., 2013) STARsuggested: (STAR, RRID:SCR_004463)FeatureCounts (Gohr and Irimia, 2019) was used to quantify mapped transcripts from total RNA-seq libraries. FeatureCountssuggested: (featureCounts, RRID:SCR_012919)DEGs with |L2FC| > 1, p-adjusted value <0.05 were considered significant and used as input in downstream Gene Ontology (GO) analysis (DAVID, v 6.8). DAVIDsuggested: (DAVID, RRID:SCR_001881)Gene set enrichment analysis (GSEA) was performed using the fgsea package in R (Sergushichev et al., 2016) Gene set enrichment analysissuggested: (Gene Set Enrichment Analysis, RRID:SCR_003199)Data visualization was carried out using ggplot2 in R. ggplot2suggested: (ggplot2, RRID:SCR_014601)Differentially expressed circRNAs were found by DESeq2 (Love, Huber and Anders, 2014) DESeq2suggested: (DESeq, RRID:SCR_000154)We used the motif data base HOmo sapiens COmprehensive MOdel COllection (HOCOMOCO) v11 transcription factor (TF) binding models (binding profiles or binding motifs) for human transcription factors. HOCOMOCOsuggested: (HOCOMOCO, RRID:SCR_005409)Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
-
