Defining the Innate Immune Responses for SARS-CoV-2-Human Macrophage Interactions
This article has been Reviewed by the following groups
Listed in
Abstract
Host innate immune response follows severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection, and it is the driver of the acute respiratory distress syndrome (ARDS) amongst other inflammatory end-organ morbidities. Such life-threatening coronavirus disease 2019 (COVID-19) is heralded by virus-induced activation of mononuclear phagocytes (MPs; monocytes, macrophages, and dendritic cells). MPs play substantial roles in aberrant immune secretory activities affecting profound systemic inflammation and end-organ malfunctions. All follow the presence of persistent viral components and virions without evidence of viral replication. To elucidate SARS-CoV-2-MP interactions we investigated transcriptomic and proteomic profiles of human monocyte-derived macrophages. While expression of the SARS-CoV-2 receptor, the angiotensin-converting enzyme 2, paralleled monocyte-macrophage differentiation, it failed to affect productive viral infection. In contrast, simple macrophage viral exposure led to robust pro-inflammatory cytokine and chemokine expression but attenuated type I interferon (IFN) activity. Both paralleled dysregulation of innate immune signaling pathways, specifically those linked to IFN. We conclude that the SARS-CoV-2-infected host mounts a robust innate immune response characterized by a pro-inflammatory storm heralding end-organ tissue damage.
Article activity feed
-
-
SciScore for 10.1101/2021.07.07.449660: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics IACUC: SARS-CoV-2 infection: Experiments involving SARS-CoV-2 were performed in the University of Nebraska Medical Center (UNMC) biosafety level 3 (BSL-3) core facility and approved by UNMC Institutional Biosafety Committee (IBC) (protocol number 20-05-027-BL3). Sex as a biological variable not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources On days 0, 1, 3, 5, and 7 during differentiation, monocytes-macrophages were stained with fluorescently-conjugated antibodies to detect human ACE2 (APC, LSBio, LS-C275129, polyclonal), CD14 (Alexa Fluor 488, eBioscience, clone 61D3), and … SciScore for 10.1101/2021.07.07.449660: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics IACUC: SARS-CoV-2 infection: Experiments involving SARS-CoV-2 were performed in the University of Nebraska Medical Center (UNMC) biosafety level 3 (BSL-3) core facility and approved by UNMC Institutional Biosafety Committee (IBC) (protocol number 20-05-027-BL3). Sex as a biological variable not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources On days 0, 1, 3, 5, and 7 during differentiation, monocytes-macrophages were stained with fluorescently-conjugated antibodies to detect human ACE2 (APC, LSBio, LS-C275129, polyclonal), CD14 (Alexa Fluor 488, eBioscience, clone 61D3), and CD16 (PE, eBioscience, eBioCB16, clone CB16), and with isotype-matched antibodies serving as negative controls. ACE2suggested: NoneLS-C275129suggested: NoneCD14suggested: NoneCD16suggested: NoneMembranes were blocked in 5% nonfat milk in TBST buffer at room temperature for 1 hour, followed by incubation with primary antibodies to IFN-α (1:500, Thermo Fisher Scientific, MA5-37518) IFN-αsuggested: NoneExperimental Models: Cell Lines Sentences Resources The virus was passaged on Vero.STAT1 knockout (KO) cells (ATCC, CCL-81-VHG) and titer was determined by plaque assay in Vero E6 cells (ATCC, CRL-1586) (Mendoza et al, 2020). Vero E6suggested: NoneVero.STAT1 KO cells were maintained for study based on their high susceptibility to virus infection due to lack of Signal Transducer and Activator of Transcription 1 (STAT1) protein required for cellular antiviral responses (Durbin et al, 1996). Vero.STAT1 KOsuggested: ATCC Cat# CCL-81-VHG, RRID:CVCL_YZ45)Vesicular stomatitis virus (VSV Indiana laboratory strain) (V-520-001-522, ATCC, VR-1238) was passaged on Vero cells (ATCC, CCL-81), and viral titer was determined using the plaque assay in Vero cells. Verosuggested: NoneSoftware and Algorithms Sentences Resources Stained cells were examined with an LSR II flow cytometer (BD Biosciences) and analyzed using BD FACSDiva software. BD FACSDivasuggested: (BD FACSDiva Software, RRID:SCR_001456)Forward primer: 5’ GACCCCAAAATCAGCGAAAT 3’, Reverse primer: 5’ TCTGGTTACTGCCAGTTGAATCTG 3’, and Probe: 5’ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ-1 3’. Probesuggested: (UniPROBE, RRID:SCR_005803)Ingenuity Pathway Analysis (IPA) (Qiagen) was used to identify the pathways and networks affected post-viral exposure. Ingenuity Pathway Analysissuggested: (Ingenuity Pathway Analysis, RRID:SCR_008653)The Reactome gene set enrichment analysis (GSEA) was conducted using ReactomeFIViz (https://reactome.org/tools/reactome-fiviz) (Wu et al, 2014), a Cytoscape application for pathway and network-based data analysis. Cytoscapesuggested: (Cytoscape, RRID:SCR_003032)The Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) local network cluster enrichment analysis was conducted using STRING database (http://string-db.org), which provides a critical assessment and integration of protein-protein interaction (PPI), including direct (physical) and indirect (functional) associations in a given organism (Szklarczyk et al, 2019). STRINGsuggested: (STRING, RRID:SCR_005223)Immunoblots were quantified using ImageJ software (NIH) relative to β-actin expression. ImageJsuggested: (ImageJ, RRID:SCR_003070)GO annotation, KEGG, Reactome GSEA, and STRING analyses were conducted using GO Resource, DAVID, ReactomeFIViz, and STRING databases, respectively. KEGGsuggested: (KEGG, RRID:SCR_012773)DAVIDsuggested: (DAVID, RRID:SCR_001881)Statistical analysis was performed using GraphPad Prism 9.1.0 software (GraphPad Software, San Diego, CA). GraphPad Prismsuggested: (GraphPad Prism, RRID:SCR_002798)GraphPadsuggested: (GraphPad Prism, RRID:SCR_002798)Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
-
