A direct capture method for purification and detection of viral nucleic acid enables epidemiological surveillance of SARS-CoV-2

  1. Subhanjan Mondal
  2. Nathan Feirer
  3. Michael Brockman
  4. Melanie A. Preston
  5. Sarah J. Teter
  6. Dongping Ma
  7. Said A. Goueli
  8. Sameer Moorji
  9. Brigitta Saul
  10. James J. Cali

Reviewed by

Read the full article See related articles

Discuss this preprint

Start a discussion What are Sciety discussions?

Listed in

Log in to save this article

Abstract

No abstract available

Article activity feed

  1. Version published to 10.1016/j.scitotenv.2021.148834
  2. ScreenIT

    SciScore for 10.1101/2021.05.06.21256753: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    Ethicsnot detected.
    Sex as a biological variablenot detected.
    RandomizationFor the purpose of comparing performance between libraries, random subsampling was performed to obtain the same number of input reads for each library using seqtk v1.2.
    Blindingnot detected.
    Power Analysisnot detected.

    Table 2: Resources

    Recombinant DNA
    SentencesResources
    The SARS-CoV-2 quantification standard was created by inserting the envelope gene (NCBI: 43740570) and the nucleocapsid gene (NCBI: 43740575) of SARS-CoV-2 into the pGEM-3z vector (Promega Corp.) using the BamH I site.
    pGEM-3z
    suggested: RRID:Addgene_26665)
    Software and Algorithms
    SentencesResources
    Manufacturer’s instructions were followed with one exception: incubation time at 50°C was increased from 10 minutes to 30 minutes, as recommended by the Swift Biosciences SARS-CoV-2 Additional Genome Coverage amplicon panel library preparation protocol.
    Swift Biosciences
    suggested: None
    Amplicon sequencing analysis: Compressed, demultiplexed reads were obtained from the Illumina MiniSeq instrument and assessed for sequencing quality using FastQC 0.11.9-0 (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/).
    FastQC
    suggested: (FastQC, RRID:SCR_014583)
    Adapter trimming was done using Fastp v0.20.132 (sequences AGATCGGAAGAGCACACGTCTGAACTCCAGTCA and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT).
    Fastp
    suggested: (fastp, RRID:SCR_016962)
    Trimmed reads were mapped to the SARS-CoV-2 reference genome (NC_045512.2) using BWA v 0.7.17.
    BWA
    suggested: (BWA, RRID:SCR_010910)
    QC metrics were generated using Picard (v 2.9.2; http://broadinstitute.github.io/picard) BedToIntervalList, CollectTargetedPcrMetrics, CollectGcBiasMetrics.
    Picard
    suggested: (Picard, RRID:SCR_006525)
    Snakemake v5.17.0 was used for workflow management on a Microsoft Azure CycleCloud instance.
    Snakemake
    suggested: (Snakemake, RRID:SCR_003475)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: We did not find any issues relating to colormaps.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  3. Version published to 10.1101/2021.05.06.21256753 on medRxiv