Differential roles of RIG-I like receptors in SARS-CoV-2 infection
This article has been Reviewed by the following groups
Listed in
Abstract
Retinoic acid-inducible gene I (RIG-I) and melanoma differentiation-associated protein 5 (MDA5) sense viral RNA and activate antiviral immune responses. Herein we investigate their functions in human epithelial cells, the primary and initial target of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). A deficiency in MDA5, RIG-I or mitochondrial antiviral signaling protein (MAVS) enhanced viral replication. The expression of the type I/III interferon (IFN) during infection was impaired in MDA5 −/− and MAVS −/− , but not in RIG-I −/− , when compared to wild type (WT) cells. The mRNA level of full-length angiotensin-converting enzyme 2 (ACE2), the cellular entry receptor for SARS-CoV-2, was ~ 2.5-fold higher in RIG-I −/− than WT cells. These data demonstrate MDA5 as the predominant SARS-CoV-2 sensor, IFN-independent induction of ACE2 and anti-SARS-CoV-2 role of RIG-I in epithelial cells.
Article activity feed
-
-
SciScore for 10.1101/2021.02.10.430677: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication Authentication: These cell lines are not listed in the database of commonly misidentified cell lines maintained by ICLAC, and have not been authenticated in our hands.
Contamination: They were routinely treated with MycoZAP (Lonza) to prevent mycoplasma contamination.Table 2: Resources
Antibodies Sentences Resources Antibodies, cells and viruses: The rabbit anti-MDA5 (Cat# 5321), RIG-I (Cat# 3743), and Actin (Cat# 8456) were purchased from Cell Signaling Technology (Danvers, MA, United States). anti-MDA5suggested: NoneR…SciScore for 10.1101/2021.02.10.430677: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication Authentication: These cell lines are not listed in the database of commonly misidentified cell lines maintained by ICLAC, and have not been authenticated in our hands.
Contamination: They were routinely treated with MycoZAP (Lonza) to prevent mycoplasma contamination.Table 2: Resources
Antibodies Sentences Resources Antibodies, cells and viruses: The rabbit anti-MDA5 (Cat# 5321), RIG-I (Cat# 3743), and Actin (Cat# 8456) were purchased from Cell Signaling Technology (Danvers, MA, United States). anti-MDA5suggested: NoneRIG-Isuggested: (Cell Signaling Technology Cat# 3743, RRID:AB_2269233)Actinsuggested: NoneExperimental Models: Cell Lines Sentences Resources Human embryonic kidney (HEK) 293 T (Cat# CRL-3216), Vero cells (monkey kidney epithelial cells, Cat# CCL-81), human lung epithelial A549 (Cat# CCL-185), human lung epithelial Calu-3 (Cat# HTB-55) cell lines were from American Type Tissue Culture (Manassas, VA, United States). HEKsuggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)Cell culture and virus infection: HEK293T/Vero cells and Calu-3/A549 cells were grown in Dulbecco’s modified Eagle’s medium or Roswell Park Memorial Institute (RPMI) 1640, respectively (Life Technologies, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS) and antibiotics/antimycotics. HEK293T/Verosuggested: NoneCalu-3/A549suggested: NoneGene knockout by CRISPR-Cas9: A gene specific guide RNA was cloned into lentiCRISPR-V2 vector and co-transfected into HEK293T cells with the packaging plasmids pVSV-G and psPAX2. HEK293Tsuggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)Forty-eight hours after transfection, the lentiviral particles in the cell culture media were applied to A549 or Calu-3 cells for 48 hours. A549suggested: NoneCalu-3suggested: NoneThe guide RNA for human RIG-I, MDA5 and MAVS was TCCTGAGCTACATGGCCCCC, CTTTCTGCCTGCAGAGGTGA, and AAGTTACCCCATGCCTGTCC respectively 23,24. MDA5suggested: NonePlaque forming assay: Quantification of infectious viral particles in cell culture supernatant was performed on Vero cell monolayer 25. Verosuggested: NoneResults from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from scite Reference Check: We found no unreliable references.
-
