1. SciScore for 10.1101/2021.02.10.430677: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    Institutional Review Board Statementnot detected.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Sex as a biological variablenot detected.
    Cell Line AuthenticationAuthentication: These cell lines are not listed in the database of commonly misidentified cell lines maintained by ICLAC, and have not been authenticated in our hands.
    Contamination: They were routinely treated with MycoZAP (Lonza) to prevent mycoplasma contamination.

    Table 2: Resources

    Antibodies
    SentencesResources
    Antibodies, cells and viruses: The rabbit anti-MDA5 (Cat# 5321), RIG-I (Cat# 3743), and Actin (Cat# 8456) were purchased from Cell Signaling Technology (Danvers, MA, United States).
    anti-MDA5
    suggested: None
    RIG-I
    suggested: (Cell Signaling Technology Cat# 3743, RRID:AB_2269233)
    Actin
    suggested: None
    Experimental Models: Cell Lines
    SentencesResources
    Human embryonic kidney (HEK) 293 T (Cat# CRL-3216), Vero cells (monkey kidney epithelial cells, Cat# CCL-81), human lung epithelial A549 (Cat# CCL-185), human lung epithelial Calu-3 (Cat# HTB-55) cell lines were from American Type Tissue Culture (Manassas, VA, United States).
    HEK
    suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)
    Cell culture and virus infection: HEK293T/Vero cells and Calu-3/A549 cells were grown in Dulbecco’s modified Eagle’s medium or Roswell Park Memorial Institute (RPMI) 1640, respectively (Life Technologies, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS) and antibiotics/antimycotics.
    HEK293T/Vero
    suggested: None
    Calu-3/A549
    suggested: None
    Gene knockout by CRISPR-Cas9: A gene specific guide RNA was cloned into lentiCRISPR-V2 vector and co-transfected into HEK293T cells with the packaging plasmids pVSV-G and psPAX2.
    HEK293T
    suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)
    Forty-eight hours after transfection, the lentiviral particles in the cell culture media were applied to A549 or Calu-3 cells for 48 hours.
    A549
    suggested: None
    Calu-3
    suggested: None
    The guide RNA for human RIG-I, MDA5 and MAVS was TCCTGAGCTACATGGCCCCC, CTTTCTGCCTGCAGAGGTGA, and AAGTTACCCCATGCCTGTCC respectively 23,24.
    MDA5
    suggested: None
    Plaque forming assay: Quantification of infectious viral particles in cell culture supernatant was performed on Vero cell monolayer 25.
    Vero
    suggested: None

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.


    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


    Results from JetFighter: We did not find any issues relating to colormaps.


    Results from scite Reference Check: We found no unreliable references.


    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

    Read the original source
    Was this evaluation helpful?