Single-cell longitudinal analysis of SARS-CoV-2 infection in human airway epithelium
This article has been Reviewed by the following groups
Listed in
- Evaluated articles (ScreenIT)
- Evaluated articles (preLights)
Abstract
SARS-CoV-2, the causative agent of COVID-19, has tragically burdened individuals and institutions around the world. There are currently no approved drugs or vaccines for the treatment or prevention of COVID-19. Enhanced understanding of SARS-CoV-2 infection and pathogenesis is critical for the development of therapeutics. To reveal insight into viral replication, cell tropism, and host-viral interactions of SARS-CoV-2 we performed single-cell RNA sequencing of experimentally infected human bronchial epithelial cells (HBECs) in air-liquid interface cultures over a time-course. This revealed novel polyadenylated viral transcripts and highlighted ciliated cells as a major target of infection, which we confirmed by electron microscopy. Over the course of infection, cell tropism of SARS-CoV-2 expands to other epithelial cell types including basal and club cells. Infection induces cell-intrinsic expression of type I and type III IFNs and IL6 but not IL1. This results in expression of interferon-stimulated genes in both infected and bystander cells. We observe similar gene expression changes from a COVID-19 patient ex vivo . In addition, we developed a new computational method termed CONditional DENSity Embedding (CONDENSE) to characterize and compare temporal gene dynamics in response to infection, which revealed genes relating to endothelin, angiogenesis, interferon, and inflammation-causing signaling pathways. In this study, we conducted an in-depth analysis of SARS-CoV-2 infection in HBECs and a COVID-19 patient and revealed genes, cell types, and cell state changes associated with infection.
Article activity feed
-
SciScore for 10.1101/2020.05.06.081695: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Experimental Models: Cell Lines Sentences Resources Using 0.3 µg total RNA extracted from mock or SARS-CoV-2-infected Huh7.5 cells at different time points, reverse transcription was performed with oligo-d(T)20 (ThermoFisher) and MarathonRT, a highly processive group II intron-encoded RT. Huh7.5suggested: RRID:CVCL_7927)Experimental Models: Organisms/Strains Sentences Resources 4.7 Cytokine measurement by multiplex immunoassay: Levels of IL6, IL1A, IL1B, IL1RN, and CXCL9 in the basolateral … SciScore for 10.1101/2020.05.06.081695: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Experimental Models: Cell Lines Sentences Resources Using 0.3 µg total RNA extracted from mock or SARS-CoV-2-infected Huh7.5 cells at different time points, reverse transcription was performed with oligo-d(T)20 (ThermoFisher) and MarathonRT, a highly processive group II intron-encoded RT. Huh7.5suggested: RRID:CVCL_7927)Experimental Models: Organisms/Strains Sentences Resources 4.7 Cytokine measurement by multiplex immunoassay: Levels of IL6, IL1A, IL1B, IL1RN, and CXCL9 in the basolateral supernatants of mock and infected HBECs were all performed by EVE technologies (Calgary, AB, Canada) using the multiplex immunoassay analyzed with a BioPlex 200. ABsuggested: NoneSoftware and Algorithms Sentences Resources The human genome, Ensembl GRCh38.98.gtf, and the SARS-CoV-2 genome, NCBI Genome database accession MT020880.1, were combined and used for alignment. Ensemblsuggested: (Ensembl, RRID:SCR_002344)Genomesuggested: (JGI Genome Portal, RRID:SCR_002383)The qPCR analysis was performed in duplicate for each of the samples and standard curves generated using SARS-CoV-2 nucleocapsid (N1) specific oligonucleotides from Integrated DNA Technologies (Coralville, IA, USA): Probe: 5’ 6FAM ACCCCGCATTACGTTTGGTGGACC-BHQ1 3’; Forward primer: 5’ GACCCCAAAATCAGCGAAAT 3’; Reverse primer: 5’ TCTGGTTACTGCCAGTTGAATCTG 3’. Probesuggested: (UniPROBE, RRID:SCR_005803)4.7 Cytokine measurement by multiplex immunoassay: Levels of IL6, IL1A, IL1B, IL1RN, and CXCL9 in the basolateral supernatants of mock and infected HBECs were all performed by EVE technologies (Calgary, AB, Canada) using the multiplex immunoassay analyzed with a BioPlex 200. BioPlexsuggested: (BioPlex, RRID:SCR_016144)All statistical analysis was performed using Prism GraphPad version 8. Prismsuggested: (PRISM, RRID:SCR_005375)GraphPadsuggested: (GraphPad Prism, RRID:SCR_002798)Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
-
Excerpt
Breaking and entering: Ravindra and colleagues report that SARS-CoV-2 overcomes the lung epithelial barrier by first infecting ciliated cells.
-
