Inhibition of SARS-CoV-2 viral entry upon blocking N- and O-glycan elaboration

Abstract

The Spike protein of SARS-CoV-2, its receptor-binding domain (RBD), and its primary receptor ACE2 are extensively glycosylated. The impact of this post-translational modification on viral entry is yet unestablished. We expressed different glycoforms of the Spike-protein and ACE2 in CRISPR-Cas9 glycoengineered cells, and developed corresponding SARS-CoV-2 pseudovirus. We observed that N- and O-glycans had only minor contribution to Spike-ACE2 binding. However, these carbohydrates played a major role in regulating viral entry. Blocking N-glycan biosynthesis at the oligomannose stage using both genetic approaches and the small molecule kifunensine dramatically reduced viral entry into ACE2 expressing HEK293T cells. Blocking O-glycan elaboration also partially blocked viral entry. Mechanistic studies suggest multiple roles for glycans during viral entry. Among them, inhibition of N-glycan biosynthesis enhanced Spike-protein proteolysis. This could reduce RBD presentation on virus, lowering binding to host ACE2 and decreasing viral entry. Overall, chemical inhibitors of glycosylation may be evaluated for COVID-19.

SciScore for 10.1101/2020.10.15.339838: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

Institutional Review Board Statement	not detected.
Randomization	not detected.
Blinding	not detected.
Power Analysis	not detected.
Sex as a biological variable	not detected.
Cell Line Authentication	Contamination: All cells were mycoplasma negative.

Table 2: Resources

Antibodies
Sentences	Resources
Goat anti-human ACE2 polyclonal antibody (AF933) and mouse anti-human ACE2 mAb MAB9332 were available from R&D Systems (Minneapolis, MA)	Goat anti-human ACE2 polyclonal antibody suggested: None anti-human ACE2 suggested: None
These studies used Alexa-647 conjugated anti-ACE2 (MAB9332, R&D systems) and anti-RBD (Sino Biologicals) antibodies.	anti-ACE2 suggested: None anti-RBD suggested: None
Experimental Models: Cell Lines
Sentence…

SciScore for 10.1101/2020.10.15.339838: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

Institutional Review Board Statement	not detected.
Randomization	not detected.
Blinding	not detected.
Power Analysis	not detected.
Sex as a biological variable	not detected.
Cell Line Authentication	Contamination: All cells were mycoplasma negative.

Table 2: Resources

Antibodies
Sentences	Resources
Goat anti-human ACE2 polyclonal antibody (AF933) and mouse anti-human ACE2 mAb MAB9332 were available from R&D Systems (Minneapolis, MA)	Goat anti-human ACE2 polyclonal antibody suggested: None anti-human ACE2 suggested: None
These studies used Alexa-647 conjugated anti-ACE2 (MAB9332, R&D systems) and anti-RBD (Sino Biologicals) antibodies.	anti-ACE2 suggested: None anti-RBD suggested: None
Experimental Models: Cell Lines
Sentences	Resources
Stable HEK293T/ACE2 cells were kindly provided by Michael Farzan (Scripps Research, Jupiter, FL).	HEK293T/ACE2 suggested: None
CRISPR-Cas9 Knockout cell lines: HEK293T CRISPR-Cas9 cells were generated by transfecting wild-type 293T cells with pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene, Plasmid# 42230) carrying single-guide RNA (sgRNA) targeting either the Core-1 β3Gal-T (C1GalT1, target site: GCAGATTCTAGCCAACATAA) or β1,2 GlcNAc-transferase (MGAT1, GTGGGGCGCTATCCTCTTTGTGG).	293T suggested: None
Spike-mutant that were produced in either: a. wild-type HEK293T, b.	HEK293T suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)
Experimental Models: Organisms/Strains
Sentences	Resources
Molecular biology: A plasmid containing the Spike protein (2019-nCov_pcDNA3.1(+)-P2A-eGFP [v1]) was kindly provided by Dr. Haisheng Yu (Institute of Laboratory Animal Science, Peking Union Medical College).	+)-P2A-eGFP [ v1] suggested: None
Software and Algorithms
Sentences	Resources
Unless mentioned otherwise, all other reagents were from either Thermo-Fisher or Sigma Chemicals.	Thermo-Fisher or Sigma suggested: None

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

Results from TrialIdentifier: No clinical trial numbers were referenced.

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

Results from JetFighter: We did not find any issues relating to colormaps.

Results from rtransparent:

Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
No protocol registration statement was detected.

Read the original source

Inhibition of SARS-CoV-2 viral entry upon blocking N- and O-glycan elaboration

This article has been Reviewed by the following groups

Listed in

Abstract

Article activity feed