Preclinical Establishment of a Divalent Vaccine against SARS-CoV-2
This article has been Reviewed by the following groups
Listed in
- Evaluated articles (ScreenIT)
Abstract
First-generation vaccines against SARS-CoV-2 do not provide adequate immune protection. Therefore, we engineered a divalent gene construct combining the receptor-binding domain (RBD) of the spike protein and the immunodominant region of the viral nucleocapsid. This fusion protein was produced in either E. coli or a recombinant baculovirus system. Subsequently, the fusion protein was mixed with adjuvant and administered to mice in a prime-booster mode. Mice (72%) produced an IgG response against both proteins (titer: 10−4–10−5) 14 days after the first booster injection, which was increased to 100% by a second booster. Comparable IgG responses were detected against the delta, gamma and omicron variants of the RBD region. Durability testing revealed IgGs beyond 90 days. In addition, cytolytic effector cell molecules were increased in lymphocytes isolated from peripheral blood. Ex vivo stimulation of T cells by nucleocapsid and RBD peptides showed antigen-specific upregulation of CD44 among the CD4+ and CD8+ T cells of vaccinated mice. No side effect was documented in the central nervous system. Cumulatively, these data represent a proof-of-principle approach alternative to existing mRNA vaccination strategies.
Article activity feed
-
-
SciScore for 10.1101/2022.02.10.479919: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics Field Sample Permit: Experimental procedures were approved by the Austrian Ministry of Science and Research (66.009/0145-WF/II/3b/2014 and 66.009/0277-WF/V/3b/2017) and conformed to the 2010/63 European Communities Council Directive.
Euthanasia Agents: At the end of the post-immunization survival period, mice were deeply anesthetized by isoflurane (at 5% with 1 L/min flow rate of tubed air) and then perfusion-fixed by transcardially applying 4% (wt/vol) paraformaldehyde and 0.1% glutaraldehyde in 0.1 M phosphate buffer (PB; pH 7.0).Sex as a biological variable Animals, blood sampling and tissue processing: A total of 18 male and 4 female mice (C57BL/6J, 8–12-week-old) were group housed under … SciScore for 10.1101/2022.02.10.479919: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics Field Sample Permit: Experimental procedures were approved by the Austrian Ministry of Science and Research (66.009/0145-WF/II/3b/2014 and 66.009/0277-WF/V/3b/2017) and conformed to the 2010/63 European Communities Council Directive.
Euthanasia Agents: At the end of the post-immunization survival period, mice were deeply anesthetized by isoflurane (at 5% with 1 L/min flow rate of tubed air) and then perfusion-fixed by transcardially applying 4% (wt/vol) paraformaldehyde and 0.1% glutaraldehyde in 0.1 M phosphate buffer (PB; pH 7.0).Sex as a biological variable Animals, blood sampling and tissue processing: A total of 18 male and 4 female mice (C57BL/6J, 8–12-week-old) were group housed under standard conditions with a 12/12 light/dark cycle. Randomization not detected. Blinding not detected. Power Analysis not detected. Table 2: Resources
Antibodies Sentences Resources After washing in PBS for 10 min, Alexa Fluor 594-tagged goat anti-mouse antibody was applied for 1 h at room temperature under continued gentle agitation. anti-mousesuggested: NoneAntibody binding was determined with goat anti-mouse HRP-conjugate (1:10,000 in assay buffer supplemented with goat serum (2% V/V)) and incubated at room temperature for 60 min. anti-mouse HRP-conjugatesuggested: (Icosagen AS Cat# A1-900-100, RRID:AB_11135309)Experimental Models: Organisms/Strains Sentences Resources Animals, blood sampling and tissue processing: A total of 18 male and 4 female mice (C57BL/6J, 8–12-week-old) were group housed under standard conditions with a 12/12 light/dark cycle. C57BL/6Jsuggested: NoneRecombinant DNA Sentences Resources For vector construction, the portion of the nucleocapsid (N100-300 aa) fused to the RBD (S300-685 aa) including 4 glycines as a hinge region was cloned into a pET-30a vector and designated ‘VieVac’ (Supplementary Figure 1A). pET-30asuggested: NoneDirectional cloning into the Gateway pEntry/D-TOPO vector: A 4-nucleotide overhang (CACC) was placed in front of the forward primer CACCATGAAAGATCTCAGTCCGCG, while TCATCGCGCTCTTCGCGGGG served as reverse primer. pEntry/D-TOPOsuggested: NoneThe original construct (engineered pET-30a/VieVac) has been used as template. pET-30a/VieVacsuggested: NoneInsertion into baculovirus and amplification in insect cells: The pEntry/D-TOPO/VieVac construct (25 ng) was shifted into the baculovirus-compatible pDEST™ 10 expression vector. pEntry/D-TOPO/VieVacsuggested: NoneIn brief, Max Efficiency® DH10Bac™ competent E. coli were transformed with the engineered pDEST™ 10 containing the VieVac recombinant construct using the heat shock method at 42 °C for 30 s. pDEST™suggested: NoneSoftware and Algorithms Sentences Resources Expression of the activation marker CD44 was measured on a FACS Canto II flow cytometer (Becton Dickinson) and analyzed using the FlowJo software (TreeStar). FlowJosuggested: (FlowJo, RRID:SCR_008520)Cell counting was performed in ImageJ. ImageJsuggested: (ImageJ, RRID:SCR_003070)In histochemical experiments, data were normalized to a surface area of 1 mm2 and expressed as means ± s.e.m, followed by one-way ANOVA in GraphPad Prism. GraphPad Prismsuggested: (GraphPad Prism, RRID:SCR_002798)Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
-
