Nafamostat–Interferon-α Combination Suppresses SARS-CoV-2 Infection In Vitro and In Vivo by Cooperatively Targeting Host TMPRSS2
This article has been Reviewed by the following groups
Listed in
- Evaluated articles (ScreenIT)
Abstract
SARS-CoV-2 and its vaccine/immune-escaping variants continue to pose a serious threat to public health due to a paucity of effective, rapidly deployable, and widely available treatments. Here, we address these challenges by combining Pegasys (IFNα) and nafamostat to effectively suppress SARS-CoV-2 infection in cell culture and hamsters. Our results indicate that Serpin E1 is an important mediator of the antiviral activity of IFNα and that both Serpin E1 and nafamostat can target the same cellular factor TMPRSS2, which plays a critical role in viral replication. The low doses of the drugs in combination may have several clinical advantages, including fewer adverse events and improved patient outcome. Thus, our study may provide a proactive solution for the ongoing pandemic and potential future coronavirus outbreaks, which is still urgently required in many parts of the world.
Article activity feed
-
-
-
SciScore for 10.1101/2021.06.16.448653: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics IACUC: All animal procedures (including surgery, anesthesia, and euthanasia as applicable) were approved by the Institutional Animal Care and Use Committee of CEA and French authorities (CETEA DSV – n° 44). Sex as a biological variable Thirty-five 6-week-old healthy female Syrian hamsters were obtained from Janvier Labs. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication not detected. Table 2: Resources
Experimental Models: Cell Lines Sentences Resources Recombinant mCherry-expressing SARS-CoV-2 (SARS-CoV-2-mCherry), and wild type human SARS-CoV-2 strains were provided by Prof. Andres Merits or the European Virus Archive global (EVAg) and propagated in … SciScore for 10.1101/2021.06.16.448653: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics IACUC: All animal procedures (including surgery, anesthesia, and euthanasia as applicable) were approved by the Institutional Animal Care and Use Committee of CEA and French authorities (CETEA DSV – n° 44). Sex as a biological variable Thirty-five 6-week-old healthy female Syrian hamsters were obtained from Janvier Labs. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication not detected. Table 2: Resources
Experimental Models: Cell Lines Sentences Resources Recombinant mCherry-expressing SARS-CoV-2 (SARS-CoV-2-mCherry), and wild type human SARS-CoV-2 strains were provided by Prof. Andres Merits or the European Virus Archive global (EVAg) and propagated in Vero E6 or Vero E6/TMPRSS2 cells. Vero E6suggested: RRID:CVCL_XD71)Vero E6/TMPRSS2suggested: NoneDrug Combination Testing and Synergy Calculations: Calu-3 cells were treated with different concentrations of two drugs and infected with SARS-CoV-2-mCherry (moi 0.1) or mock. Calu-3suggested: NoneExperimental Models: Organisms/Strains Sentences Resources RT-PCR was performed using SuperScript™ III One-Step qRT-PCR System kit (commercial kit #1732-020, Life Technologies) with primers ORF1ab_Fw: CCGCAAGGTTCTTCTTCGTAAG, ORF1ab_Rv: TGCTATGTTTAGTGTTCCAGTTTTC, ORF1ab_probe: Hex-AAGGATCAGTGCCAAGCTCGTCGCC-BHQ-1 targeting a region on ORF1ab. Hex-AAGGATCAGTGCCAAGCTCG TCGCC-BHQ-1suggested: NoneSoftware and Algorithms Sentences Resources The half-maximal cytotoxic concentration (CC50) for each compound was calculated based on viability/death curves obtained on mock-infected cells after non-linear regression analysis with a variable slope using GraphPad Prism software version 7.0a. GraphPad Prismsuggested: (GraphPad Prism, RRID:SCR_002798)The expected responses were calculated based on the ZIP reference model using SynergyFinder version 2 [17, 18]. SynergyFindersuggested: (SynergyFinder, RRID:SCR_019318)Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:
Identifier Status Title NCT04623021 Completed A Study Evaluating the Efficacy and Safety of CKD-314 (Nafab… NCT04473053 Recruiting Rapid Experimental Medicine for COVID-19 NCT04390594 Recruiting Efficacy and Safety Evaluation of Treatment Regimens in Adul… NCT04483960 Recruiting Australasian COVID-19 Trial (ASCOT) ADAptive Platform Trial Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
-