A Comprehensive Review of Silene Genus Using New ITS Primer: Phytochemical And Heavy Metal Profiling of Silene Vulgaris (Moench) Garcke

Silene vulgaris (Moench) garcke is an annual herbaceous plant, commonly referred to as bladder campion; it contains several noteworthy phytochemicals, including alkaloids, tannins, flavonoids, saponins and triterpenoids. The availability of such metabolites makes S.vulgaris a valuable plant in conventional medication for treating various ailments, including inflammation, infections, and digestive issues. This work involved quantifying phytochemicals, namely tannins, using the vanillin method, which employed catechine as a blank. Moreover, dragendorff reagent was used to assess the alkaloids content. A molecular analysis of the S. vulgaris genus was also done using two different types of markers called Internal Transcribed Spacers (ITS). Using primer-Blast, Yazid.A construct the new set of primers, which consisted of the primer with the forward direction [ITS5_YA] (GGAAGGAGAAGTCGTAACAAGGT) and the primer with the reverse direction [ITS4_YA] (GTTCGCTCGCCGTTACTAGG). A universal pair of primers was included in the second primer set: a forward primer [ITS1] (TCCGTAGGTGAACCTGCGG) and a reverse primer [ITS4] (GTTCGCTCGCCGTTACTAGG). Furthermore, an elemental analysis was conducted on various parts of S.vulgaris using atomic absorption spectroscopy (AAS) to ascertain the plant's nutritional composition, bioaccumulation characteristics, and environmental adaptation, facilitating comprehension of its therapeutic potential and ecological importance.