SARS-CoV-2 Delta variant induces enhanced pathology and inflammatory responses in K18-hACE2 mice
This article has been Reviewed by the following groups
Listed in
- Evaluated articles (ScreenIT)
Abstract
The COVID-19 pandemic has been fueled by SARS-CoV-2 novel variants of concern (VOC) that have increased transmissibility, receptor binding affinity, and other properties that enhance disease. The goal of this study is to characterize unique pathogenesis of the Delta VOC strain in the K18-hACE2-mouse challenge model. Challenge studies suggested that the lethal dose of Delta was higher than Alpha or Beta strains. To characterize the differences in the Delta strain’s pathogenesis, a time-course experiment was performed to evaluate the overall host response to Alpha or Delta variant challenge. qRT-PCR analysis of Alpha- or Delta-challenged mice revealed no significant difference between viral RNA burden in the lung, nasal wash or brain. However, histopathological analysis revealed high lung tissue inflammation and cell infiltration following Delta- but not Alpha-challenge at day 6. Additionally, pro-inflammatory cytokines were highest at day 6 in Delta-challenged mice suggesting enhanced pneumonia. Total RNA-sequencing analysis of lungs comparing challenged to no challenge mice revealed that Alpha-challenged mice have more total genes differentially activated. Conversely, Delta-challenged mice have a higher magnitude of differential gene expression. Delta-challenged mice have increased interferon-dependent gene expression and IFN-γ production compared to Alpha. Analysis of TCR clonotypes suggested that Delta challenged mice have increased T-cell infiltration compared to Alpha challenged. Our data suggest that Delta has evolved to engage interferon responses in a manner that may enhance pathogenesis. The in vivo and in silico observations of this study underscore the need to conduct experiments with VOC strains to best model COVID-19 when evaluating therapeutics and vaccines.
Article activity feed
-
-
SciScore for 10.1101/2022.01.18.476863: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics IACUC: Biosafety, Animal, and Ethics statement: All research performed was approved by West Virginia University IACUC protocol number 2004034204.
Field Sample Permit: All SARS-CoV-2 viral propagation or challenge studies were conducted in the West Virginia University Biosafety Laboratory Level 3 facility under the IBC protocol number 20-04-01.Sex as a biological variable For variant comparison studies, K18-hACE2 mice were intranasally challenged with a volume of 50 uL (25uL per nare) at: 103 PFU/dose (8 week old male and female received WA-1 or Beta; 12 week old female mice received Alpha; 14 week old female received Delta), or 104 PFU/dose (17 week old female received WA-1; 8 week old male … SciScore for 10.1101/2022.01.18.476863: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics IACUC: Biosafety, Animal, and Ethics statement: All research performed was approved by West Virginia University IACUC protocol number 2004034204.
Field Sample Permit: All SARS-CoV-2 viral propagation or challenge studies were conducted in the West Virginia University Biosafety Laboratory Level 3 facility under the IBC protocol number 20-04-01.Sex as a biological variable For variant comparison studies, K18-hACE2 mice were intranasally challenged with a volume of 50 uL (25uL per nare) at: 103 PFU/dose (8 week old male and female received WA-1 or Beta; 12 week old female mice received Alpha; 14 week old female received Delta), or 104 PFU/dose (17 week old female received WA-1; 8 week old male and female received Alpha or Beta; 20 week old female received Delta). Randomization not detected. Blinding Lungs were scored for chronic and acute inflammation in the lung parenchyma, blood vessels, and airways by a blinded pathologist. Power Analysis not detected. Cell Line Authentication not detected. Table 2: Resources
Experimental Models: Cell Lines Sentences Resources SARS-CoV-2 strains were propagated in Vero E6 cells (ATCC-CRL-1586). Vero E6suggested: NoneExperimental Models: Organisms/Strains Sentences Resources K18-hACE2-mice were purchased from Jackson Laboratory K18-hACE2-micesuggested: NoneFor variant comparison studies, K18-hACE2 mice were intranasally challenged with a volume of 50 uL (25uL per nare) at: 103 PFU/dose (8 week old male and female received WA-1 or Beta; 12 week old female mice received Alpha; 14 week old female received Delta), or 104 PFU/dose (17 week old female received WA-1; 8 week old male and female received Alpha or Beta; 20 week old female received Delta). K18-hACE2suggested: RRID:IMSR_GPT:T037657)Software and Algorithms Sentences Resources We utilized nucleocapsid primers (F: ATGCTGCAATCGTGCTACAA; R: GACTGCCGCCTCTGCTC); and TaqMan probe (IDT:/56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/) that were synthesized according to Winkler. et al, 2020 (43). ATGCTGCAATCGTGCTACAAsuggested: NoneGACTGCCGCCTCTGCTC)suggested: NoneStatistical analyses: All statistical analyses were performed using GraphPad Prism version 9. GraphPad Prismsuggested: (GraphPad Prism, RRID:SCR_002798)Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:One well known caveat of the K18-hACE2-mouse model is the fact that WA-1, Alpha and Beta strains enter the brain (43,45,46,56–62). However, it appears that Delta variant remains more localized in the lungs of challenged mice (Fig. 3) (63). It’s generally accepted that the K18-hACE2-mice reach morbidity due to brain infection, supported by manifestations of disease including hypothermia, and inflammatory profiles. It is possible that the absence of brain infection due to Delta allows for an increased survival time, leaving more time for the development of severe infection and pneumonia in the lung, which could make Delta a better strain for modeling the respiratory phenotypes of COVID-19 disease in K18-hACE2 mice. We appreciate that the K18-hACE2-mouse model has caveats to consider. The transgenic model expressing human ACE2 in addition to mouse ACE2 addresses SARS-CoV-2’s higher affinity for binding human ACE2, which reduces species tropism and allows virus to cause lethal disease in the mice. As is common in transgenic protein expression, hACE2 under the epithelial cell cytokeratin-18 (K18) promoter is not expressed with the identical tissue localization as it would be in humans. Therefore, viral localization should always be carefully considered. Our observations show that Delta accomplishes lung infection in the mouse and induces strong pneumonia. One popular alternative to the K18-hACE2 mouse model is the Syrian Golden Hamster. After SARS-CoV-2 challenge, hamsters develop...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
-
