Clinico-histopathologic and single-nuclei RNA-sequencing insights into cardiac injury and microthrombi in critical COVID-19

  1. Michael I. Brener
  2. Michelle L. Hulke
  3. Nobuaki Fukuma
  4. Stephanie Golob
  5. Robert S. Zilinyi
  6. Zhipeng Zhou
  7. Christos Tzimas
  8. Ilaria Russo
  9. Claire McGroder
  10. Ryan D. Pfeiffer
  11. Alexander Chong
  12. Geping Zhang
  13. Daniel Burkhoff
  14. Martin B. Leon
  15. Mathew S. Maurer
  16. Jeffrey W. Moses
  17. Anne-Catrin Uhlemann
  18. Hanina Hibshoosh
  19. Nir Uriel
  20. Matthias J. Szabolcs
  21. Björn Redfors
  22. Charles C. Marboe
  23. Matthew R. Baldwin
  24. Nathan R. Tucker
  25. Emily J. Tsai

Reviewed by

Read the full article

Listed in

Log in to save this article

Abstract

No abstract available

Article activity feed

  1. Version published to 10.1172/jci.insight.154633
  2. ScreenIT

    SciScore for 10.1101/2021.07.27.453843: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    EthicsConsent: Next-of-kin provided informed consent for autopsy.
    IRB: Patient and autopsy data were manually abstracted from the electronic medical record, as approved by the CUIMC Institutional Review Board (IRB-AAS9835).
    Sex as a biological variablenot detected.
    RandomizationBriefly, CellphoneDB identifies and compares ligand-receptor interaction pairs between cell types and compares the observed interactions to the expected interactions of a null distribution generated from randomly permuted cell labels.
    BlindingAnalysis of all digital slides was performed independently, in parallel, by at least two blinded investigators, using ImageScope (
    Power Analysisnot detected.

    Table 2: Resources

    Antibodies
    SentencesResources
    Microscopic imaging and quantitative analysis of histopathologic findings: Four micron thick sections of left and right ventricular FFPE tissue blocks per decedent were cut and labeled using an automated staining platform (Leica Bond 3, Leica Biosystems, Buffalo Grove, IL) with the following monoclonal antibodies against: C4d (Leica Biosystems
    C4d
    suggested: None
    , BOND Ready-to-Use Primary Antibody, clone SP91) in order to detect cell damage or, in the case of cardiomyocytes, necrosis; CD61 (Cell Marque, prediluted primary antibody, clone EP65,) to identify platelet-rich microthrombi; and CD31 (Leica Biosystems
    CD61
    suggested: None
    CD31
    suggested: None
    Software and Algorithms
    SentencesResources
    Analysis of all digital slides was performed independently, in parallel, by at least two blinded investigators, using ImageScope (
    ImageScope
    suggested: (ImageScope, RRID:SCR_014311)
    60 To remove homopolymers (A30, T30, G30, and C30) and the template switch oligo sequence (CCCATGTACTCTGCGTTGATACCACTGCTT and its complement AAGCAGTGGTATCAACGCAGA GTACATGGG), reads were trimmed using Cutadapt (v2.8)61 with default parameters.
    Cutadapt
    suggested: (cutadapt, RRID:SCR_011841)
    The remaining samples were filtered using CellBender v2.0 62 with default settings to remove the ambient RNA byproducts of nuclear isolation.
    CellBender
    suggested: None
    Pathways were considered enriched within a cell type if identified as such by both Reactome and GSEA Msigdb (BH FDR adjusted P- value of < 0.05).
    Reactome
    suggested: (Reactome, RRID:SCR_003485)
    Default parameters were used for the analysis (10% threshold for cells expressing ligands and receptors, p-value = 0.05, 1000 iterations for generation of null distribution, curated interactions list compiled by CellphoneDB from UniProt, Ensembl, PDB, IMEx consortium, and IUPHAR).
    CellphoneDB
    suggested: (CellPhoneDB, RRID:SCR_017054)
    Analyses were performed using SAS (v9.4, SAS Institute) and R(v3.5.1).
    SAS Institute
    suggested: (Statistical Analysis System, RRID:SCR_008567)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

    Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
    Limitations: Patients were hospitalized prior to FDA-approved therapies, and our initial local practice, as of April 15, 2020, was to reserve steroids for only the most critically-ill appearing patients. Therefore, the nearly statistically significant association of steroid use with increased odds of cardiac microthrombi may reflect some confounding by an unmeasured greater severity of illness. During the study period, testing for other respiratory viruses (i.e., influenza or adenovirus) was not routine. Reassuringly, a study of suspected acute myocarditis patients earlier in the pandemic offers evidence that viral co-infection occurs <5% of the time.54 Our observed associations between clinical variables and presence of cardiac microthrombi may be affected by unmeasured residual confounding and missingness, though we were able to adjust for several confounders via CBPS and we employed multiple imputation. The magnitude of the effect estimates may not be generalizable given our single-center study design. While affording previously unattainable resolution of cell type-specific transcription, snRNA-seq analyses have technological limitations which are discussed extensively in the results and on-line methods as they arise. Importantly, SARS-CoV-2 resides in the cytosol, which is removed during sample processing for snRNA-seq. As such, we could not and did not observe SARS-CoV-2 transcripts in our analysis and must rely upon indirect evidence of viral infection of individual cel...

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: We did not find any issues relating to colormaps.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  3. Version published to 10.1101/2021.07.27.453843v1 on bioRxiv