Variations in Cell Surface ACE2 Levels Alter Direct Binding of SARS-CoV-2 Spike Protein and Viral Infectivity: Implications for Measuring Spike Protein Interactions with Animal ACE2 Orthologs

  1. Soheila Kazemi
  2. Alberto Domingo López-Muñoz
  3. Jaroslav Hollý
  4. Ling Jin
  5. Jonathan W. Yewdell
  6. Brian P. Dolan

Reviewed by

Read the full article See related articles

Listed in

Log in to save this article

Abstract

SARS-CoV-2 is a zoonotic virus responsible for the worst global pandemic in a century. An understanding of how the virus can infect other vertebrate species is important for controlling viral spread and understanding the natural history of the virus.

Article activity feed

  1. Version published to 10.1128/jvi.00256-22
  2. ScreenIT

    SciScore for 10.1101/2021.10.21.465386: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    Ethicsnot detected.
    Sex as a biological variablenot detected.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Cell Line AuthenticationContamination: Cell lines were checked regularly for any mycoplasma contamination and were tested negative for the presence of mycoplasma contamination using Universal Mycoplasma Detection Kit (ATCC® 30-1012K™)

    Table 2: Resources

    Antibodies
    SentencesResources
    All Thy1.1 antibodies (unlabeled, and FITC conjugated) were from eBiosciences and APC-coupled anti-ACE2 antibody was from Abeomics.
    anti-ACE2
    suggested: None
    Surface expression of hACE2 was confirmed by flow cytometry using anti-hACE2 antibody.
    anti-hACE2
    suggested: None
    Briefly, cells were harvested and washed in specific sorting buffer, incubated with anti-Thy1.1 antibody for 30 min at 4°C.
    anti-Thy1.1
    suggested: None
    Experimental Models: Cell Lines
    SentencesResources
    For the generation of ACE2 expressing BHK-21 cells, human ACE2 cDNA (kindly provided by Sonja Best, NIH/NIAID) was used as a PCR template.
    BHK-21
    suggested: ATCC Cat# CRL-6281, RRID:CVCL_1914)
    Briefly, BHK-21 and 293FT cells were plated together in 6-well plates and infected with recombinant T7-expressing vaccinia virus (vTF7-3).
    293FT
    suggested: ATCC Cat# PTA-5077, RRID:CVCL_6911)
    Virus was tittered on BHK-21/hACE2-BFP cells and counting visible plaques 72 hours post infection.
    BHK-21/hACE2-BFP
    suggested: None
    For infection studies, HRT-18G cells and their derivatives were plated in 24 well plates, 24 hours prior to infection to achieve confluency.
    HRT-18G
    suggested: ATCC Cat# CRL-11663, RRID:CVCL_2515)
    Recombinant DNA
    SentencesResources
    The pSBbi-BH plasmid was a kind gift from Eric Kowarz (Addgene #60515).
    pSBbi-BH
    suggested: RRID:Addgene_60515)
    ACE2 orthologs were cloned into the plasmid pCAGGS-IRES-Thy1.1, as described previously [53].
    pCAGGS-IRES-Thy1.1
    suggested: None
    Cell transfection and stable cell line generation: For the generation of BHK-21 cells stably expressing human ACE2, the pCMV(CAT)T7-SB100 plasmid (encoding transposase required to generate stable transgene-expressing cell lines) was co-transfected with pSBbi-BH hACE2 using TransIT-LT1 Transfection Reagent (Mirus Bio). pCMV(CAT)T7-SB100 was a kind gift from Zsuzsanna Izsvak (Addgene #34879).
    pSBbi-BH hACE2
    suggested: None
    pCMV(CAT)T7-SB100
    suggested: RRID:Addgene_34879)
    The backbone vector pVSV-eGFP-dG (Addgene # 31842) was linearized by PCR with primers AGTGTCAAGGAAACAGATCGATCTC and CCAAATCAACTTGTGATATCATGC.
    pVSV-eGFP-dG
    suggested: None
    The resulting pVSV-eGFP-deltaG_SARS-CoV-2 Spike vector was verified by sanger sequencing.
    pVSV-eGFP-deltaG_SARS-CoV-2
    suggested: None
    Software and Algorithms
    SentencesResources
    Statistical analysis: All statistical analyses were performed using GraphPad Prism Software version 9.0 (
    GraphPad Prism
    suggested: (GraphPad Prism, RRID:SCR_002798)
    GraphPad Software Inc.
    GraphPad
    suggested: (GraphPad Prism, RRID:SCR_002798)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: We did not find any issues relating to colormaps.

    Results from rtransparent:
    • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
    • No funding statement was detected.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  3. Version published to 10.1101/2021.10.21.465386v1 on bioRxiv