Variations in Cell Surface ACE2 Levels Alter Direct Binding of SARS-CoV-2 Spike Protein and Viral Infectivity: Implications for Measuring Spike Protein Interactions with Animal ACE2 Orthologs
This article has been Reviewed by the following groups
Listed in
- Evaluated articles (ScreenIT)
Abstract
SARS-CoV-2 is a zoonotic virus responsible for the worst global pandemic in a century. An understanding of how the virus can infect other vertebrate species is important for controlling viral spread and understanding the natural history of the virus.
Article activity feed
-
-
SciScore for 10.1101/2021.10.21.465386: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics not detected. Sex as a biological variable not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication Contamination: Cell lines were checked regularly for any mycoplasma contamination and were tested negative for the presence of mycoplasma contamination using Universal Mycoplasma Detection Kit (ATCC® 30-1012K™) Table 2: Resources
Antibodies Sentences Resources All Thy1.1 antibodies (unlabeled, and FITC conjugated) were from eBiosciences and APC-coupled anti-ACE2 antibody was from Abeomics. anti-ACE2suggested: NoneSurface expression of hACE2 was confirmed by flow cytometry using anti-hACE2 antibody. anti-hACE2suggested: NoneBriefly, cells were … SciScore for 10.1101/2021.10.21.465386: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics not detected. Sex as a biological variable not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication Contamination: Cell lines were checked regularly for any mycoplasma contamination and were tested negative for the presence of mycoplasma contamination using Universal Mycoplasma Detection Kit (ATCC® 30-1012K™) Table 2: Resources
Antibodies Sentences Resources All Thy1.1 antibodies (unlabeled, and FITC conjugated) were from eBiosciences and APC-coupled anti-ACE2 antibody was from Abeomics. anti-ACE2suggested: NoneSurface expression of hACE2 was confirmed by flow cytometry using anti-hACE2 antibody. anti-hACE2suggested: NoneBriefly, cells were harvested and washed in specific sorting buffer, incubated with anti-Thy1.1 antibody for 30 min at 4°C. anti-Thy1.1suggested: NoneExperimental Models: Cell Lines Sentences Resources For the generation of ACE2 expressing BHK-21 cells, human ACE2 cDNA (kindly provided by Sonja Best, NIH/NIAID) was used as a PCR template. BHK-21suggested: ATCC Cat# CRL-6281, RRID:CVCL_1914)Briefly, BHK-21 and 293FT cells were plated together in 6-well plates and infected with recombinant T7-expressing vaccinia virus (vTF7-3). 293FTsuggested: ATCC Cat# PTA-5077, RRID:CVCL_6911)Virus was tittered on BHK-21/hACE2-BFP cells and counting visible plaques 72 hours post infection. BHK-21/hACE2-BFPsuggested: NoneFor infection studies, HRT-18G cells and their derivatives were plated in 24 well plates, 24 hours prior to infection to achieve confluency. HRT-18Gsuggested: ATCC Cat# CRL-11663, RRID:CVCL_2515)Recombinant DNA Sentences Resources The pSBbi-BH plasmid was a kind gift from Eric Kowarz (Addgene #60515). pSBbi-BHsuggested: RRID:Addgene_60515)ACE2 orthologs were cloned into the plasmid pCAGGS-IRES-Thy1.1, as described previously [53]. pCAGGS-IRES-Thy1.1suggested: NoneCell transfection and stable cell line generation: For the generation of BHK-21 cells stably expressing human ACE2, the pCMV(CAT)T7-SB100 plasmid (encoding transposase required to generate stable transgene-expressing cell lines) was co-transfected with pSBbi-BH hACE2 using TransIT-LT1 Transfection Reagent (Mirus Bio). pCMV(CAT)T7-SB100 was a kind gift from Zsuzsanna Izsvak (Addgene #34879). pSBbi-BH hACE2suggested: NonepCMV(CAT)T7-SB100suggested: RRID:Addgene_34879)The backbone vector pVSV-eGFP-dG (Addgene # 31842) was linearized by PCR with primers AGTGTCAAGGAAACAGATCGATCTC and CCAAATCAACTTGTGATATCATGC. pVSV-eGFP-dGsuggested: NoneThe resulting pVSV-eGFP-deltaG_SARS-CoV-2 Spike vector was verified by sanger sequencing. pVSV-eGFP-deltaG_SARS-CoV-2suggested: NoneSoftware and Algorithms Sentences Resources Statistical analysis: All statistical analyses were performed using GraphPad Prism Software version 9.0 ( GraphPad Prismsuggested: (GraphPad Prism, RRID:SCR_002798)GraphPad Software Inc. GraphPadsuggested: (GraphPad Prism, RRID:SCR_002798)Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
-
