Protective activity of mRNA vaccines against ancestral and variant SARS-CoV-2 strains

Article activity feed

1. Version published to 10.1126/scitranslmed.abm3302

   Feb 2, 2022
2. 

   ScreenIT

   Aug 28, 2021

   SciScore for 10.1101/2021.08.25.457693: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Ethics	IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01).
   Sex as a biological variable	Mouse experiments: Female 129S2 (catalog 287) and K18-hACE2 C57BL/6 (catalog 034860) mice were purchased from the Charles River and The Jackson Laboratory, respectively.
   Randomization	not detected.
   Blinding	not detected.
   Power Analysis	not detected.
   Cell Line Authentication	Contamination: All cells routinely tested negative for mycoplasma using a PCR-based assay.

   Table 2: Resources

   Antibodies
   Sentences	Resources
   Plates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, …

   SciScore for 10.1101/2021.08.25.457693: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Ethics	IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01).
   Sex as a biological variable	Mouse experiments: Female 129S2 (catalog 287) and K18-hACE2 C57BL/6 (catalog 034860) mice were purchased from the Charles River and The Jackson Laboratory, respectively.
   Randomization	not detected.
   Blinding	not detected.
   Power Analysis	not detected.
   Cell Line Authentication	Contamination: All cells routinely tested negative for mycoplasma using a PCR-based assay.

   Table 2: Resources

   Antibodies
   Sentences	Resources
   Plates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 (Liu et al., 2021c) anti-S antibodies and HRP-conjugated goat anti-mouse IgG (Sigma, 12-349) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin.	SARS2-57 suggested: None SARS2-71 suggested: None anti-S suggested: None anti-mouse IgG suggested: (Millipore Cat# 12-349, RRID:AB_390192)
   Following blocking with FcγR antibody (BioLegend, clone 93), cells were stained on ice with CD45 BUV395 (BD BioSciences clone 30-F11), CD4 PE (BD BioSciences clone GK1.5)	CD45 suggested: None
   Experimental Models: Cell Lines
   Sentences	Resources
   Vero-TMPRSS2 cells were supplemented with 5 μg/mL of blasticidin.	Vero-TMPRSS2 suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)
   Vero-hACE2-TMPRSS2 cells were supplemented with 10 µg/mL of puromycin.	Vero-hACE2-TMPRSS2 suggested: None
   Experimental Models: Organisms/Strains
   Sentences	Resources
   Heterozygous K18-hACE2 C57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) and 129 mice (strain: 129S2/SvPasCrl) were obtained from The Jackson Laboratory and Charles River Laboratories, respectively.	C57BL/6J suggested: RRID:MGI:3589388) 129S2/SvPasCrl suggested: RRID:IMSR_CRL:287)
   Mouse experiments: Female 129S2 (catalog 287) and K18-hACE2 C57BL/6 (catalog 034860) mice were purchased from the Charles River and The Jackson Laboratory, respectively.	C57BL/6 suggested: None
   Homogenates then were analyzed for cytokines and chemokines by Eve Technologies Corporation (Calgary, AB, Canada) using their Mouse Cytokine Array/Chemokine Array 31-Plex (MD31) platform.	AB suggested: None
   Recombinant DNA
   Sentences	Resources
   Briefly, mammalian cell codon-optimized nucleotide sequences coding for the soluble ectodomain of the S protein of SARS-CoV-2 including a C-terminal thrombin cleavage site, T4 foldon trimerization domain, and hexahistidine tag were cloned into mammalian expression vector pCAGGS.	pCAGGS suggested: RRID:Addgene_18926)
   Software and Algorithms
   Sentences	Resources
   Graphs were generated using Graphpad Prism v9.	Graphpad Prism suggested: (GraphPad Prism, RRID:SCR_002798)
   Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/).	GACTGCCGCCTCTGCTC suggested: None Probe suggested: (UniPROBE, RRID:SCR_005803)
   Analysis was performed on a BD LSRFortessa X-20 cytometer, using FlowJo X 10.0 software.	FlowJo suggested: (FlowJo, RRID:SCR_008520)
   QUANTIFICATION AND STATISTICAL ANALYSIS: Statistical significance was assigned when P values were < 0.05 using Prism Version 10 (GraphPad)	GraphPad suggested: (GraphPad Prism, RRID:SCR_002798)

   ---

   Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

   ---

   Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

   Limitations of study: We note several limitations in our study. (1) The studies in 129S2 mice precluded challenge with B.1.617.2, as it does not infect murine cells because it lacks an N501Y mutation. The generation of recombinant SARS-CoV-2 strains with spike genes encoding B.1.617.2 and an N501Y mutation could overcome this limitation. (2) Female 129S2 and K18-hACE2 mice were used to allow for group caging of the large cohorts required for these multi-arm vaccination studies. Follow-up experiments in male mice are needed to confirm results are not sex-biased. (3) We used lower vaccine dosing as a model for waning immunity. Studies that directly address durability of immune responses and protection are needed for corroboration. (4) We used historical, variant, or mixed mRNA vaccine formulations with homologous boosting schemes. Animals studies that test heterologous boosting (mRNA-1273 prime followed by mRNA-1273.351 boost) (Wu et al., 2021) also are needed to support clinical trials. (5) Our studies focused on immunogenicity and protection in two strains of mice because of the ability to set up large animal cohorts and the tools available for analysis. These results require confirmation in other animal models of SARS-CoV-2 infection including hamsters and non-human primates (Muñoz-Fontela et al., 2020). (6) We did not establish direct immunological correlates of vaccine protection or failure for all vaccine and challenge strain pairs. While some relationships were more pred...

   ---

   Results from TrialIdentifier: We found the following clinical trial numbers in your paper:
   

   Identifier	Status	Title
   NCT04927065	Active, not recruiting	A Study to Evaluate the Immunogenicity and Safety of mRNA-12…

   ---

   Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

   ---

   Results from JetFighter: We did not find any issues relating to colormaps.

   ---

   Results from rtransparent:

   • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
   • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
   • No protocol registration statement was detected.

   ---

   Results from scite Reference Check: We found no unreliable references.

   ---

   Read the original source
3. 

   Version published to 10.1101/2021.08.25.457693v1 on bioRxiv

   Aug 26, 2021