Protective activity of mRNA vaccines against ancestral and variant SARS-CoV-2 strains
This article has been Reviewed by the following groups
Listed in
- Evaluated articles (ScreenIT)
Abstract
Although mRNA vaccines encoding the spike protein of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) prevent COVID-19, the emergence of new viral variants jeopardizes their efficacy. Here, we assessed the immunogenicity and protective activity of historical (mRNA-1273, designed for Wuhan-1 spike protein) or modified (mRNA-1273.351, designed for B.1.351 spike protein) Moderna mRNA vaccines in 129S2 and K18-hACE2 mice. Mice were immunized with either high-dose or low-dose formulations of the mRNA vaccines, where low-dose vaccination modeled suboptimal immune responses. Immunization with formulations at either dose induced neutralizing antibodies in serum against ancestral SARS-CoV-2 WA1/2020 and several virus variants, although serum titers were lower against the B.1.617.2 (Delta) virus. Protection against weight loss and lung pathology was observed with all high-dose vaccines against all viruses. However, low-dose formulations of the vaccines, which produced lower magnitude antibody and T cell responses, showed breakthrough lung infections with B.1.617.2 and development of pneumonia in K18-hACE2 mice. Thus, in individuals with reduced immunity after mRNA vaccination, breakthrough infection and disease may occur with some SARS-CoV-2 variants.
Article activity feed
-
-
SciScore for 10.1101/2021.08.25.457693: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01). Sex as a biological variable Mouse experiments: Female 129S2 (catalog 287) and K18-hACE2 C57BL/6 (catalog 034860) mice were purchased from the Charles River and The Jackson Laboratory, respectively. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication Contamination: All cells routinely tested negative for mycoplasma using a PCR-based assay. Table 2: Resources
Antibodies Sentences Resources Plates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, … SciScore for 10.1101/2021.08.25.457693: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01). Sex as a biological variable Mouse experiments: Female 129S2 (catalog 287) and K18-hACE2 C57BL/6 (catalog 034860) mice were purchased from the Charles River and The Jackson Laboratory, respectively. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication Contamination: All cells routinely tested negative for mycoplasma using a PCR-based assay. Table 2: Resources
Antibodies Sentences Resources Plates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 (Liu et al., 2021c) anti-S antibodies and HRP-conjugated goat anti-mouse IgG (Sigma, 12-349) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin. SARS2-57suggested: NoneSARS2-71suggested: Noneanti-Ssuggested: Noneanti-mouse IgGsuggested: (Millipore Cat# 12-349, RRID:AB_390192)Following blocking with FcγR antibody (BioLegend, clone 93), cells were stained on ice with CD45 BUV395 (BD BioSciences clone 30-F11), CD4 PE (BD BioSciences clone GK1.5) CD45suggested: NoneExperimental Models: Cell Lines Sentences Resources Vero-TMPRSS2 cells were supplemented with 5 μg/mL of blasticidin. Vero-TMPRSS2suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)Vero-hACE2-TMPRSS2 cells were supplemented with 10 µg/mL of puromycin. Vero-hACE2-TMPRSS2suggested: NoneExperimental Models: Organisms/Strains Sentences Resources Heterozygous K18-hACE2 C57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) and 129 mice (strain: 129S2/SvPasCrl) were obtained from The Jackson Laboratory and Charles River Laboratories, respectively. C57BL/6Jsuggested: RRID:MGI:3589388)129S2/SvPasCrlsuggested: RRID:IMSR_CRL:287)Mouse experiments: Female 129S2 (catalog 287) and K18-hACE2 C57BL/6 (catalog 034860) mice were purchased from the Charles River and The Jackson Laboratory, respectively. C57BL/6suggested: NoneHomogenates then were analyzed for cytokines and chemokines by Eve Technologies Corporation (Calgary, AB, Canada) using their Mouse Cytokine Array/Chemokine Array 31-Plex (MD31) platform. ABsuggested: NoneRecombinant DNA Sentences Resources Briefly, mammalian cell codon-optimized nucleotide sequences coding for the soluble ectodomain of the S protein of SARS-CoV-2 including a C-terminal thrombin cleavage site, T4 foldon trimerization domain, and hexahistidine tag were cloned into mammalian expression vector pCAGGS. pCAGGSsuggested: RRID:Addgene_18926)Software and Algorithms Sentences Resources Graphs were generated using Graphpad Prism v9. Graphpad Prismsuggested: (GraphPad Prism, RRID:SCR_002798)Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/). GACTGCCGCCTCTGCTCsuggested: NoneProbesuggested: (UniPROBE, RRID:SCR_005803)Analysis was performed on a BD LSRFortessa X-20 cytometer, using FlowJo X 10.0 software. FlowJosuggested: (FlowJo, RRID:SCR_008520)QUANTIFICATION AND STATISTICAL ANALYSIS: Statistical significance was assigned when P values were < 0.05 using Prism Version 10 (GraphPad) GraphPadsuggested: (GraphPad Prism, RRID:SCR_002798)Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations of study: We note several limitations in our study. (1) The studies in 129S2 mice precluded challenge with B.1.617.2, as it does not infect murine cells because it lacks an N501Y mutation. The generation of recombinant SARS-CoV-2 strains with spike genes encoding B.1.617.2 and an N501Y mutation could overcome this limitation. (2) Female 129S2 and K18-hACE2 mice were used to allow for group caging of the large cohorts required for these multi-arm vaccination studies. Follow-up experiments in male mice are needed to confirm results are not sex-biased. (3) We used lower vaccine dosing as a model for waning immunity. Studies that directly address durability of immune responses and protection are needed for corroboration. (4) We used historical, variant, or mixed mRNA vaccine formulations with homologous boosting schemes. Animals studies that test heterologous boosting (mRNA-1273 prime followed by mRNA-1273.351 boost) (Wu et al., 2021) also are needed to support clinical trials. (5) Our studies focused on immunogenicity and protection in two strains of mice because of the ability to set up large animal cohorts and the tools available for analysis. These results require confirmation in other animal models of SARS-CoV-2 infection including hamsters and non-human primates (Muñoz-Fontela et al., 2020). (6) We did not establish direct immunological correlates of vaccine protection or failure for all vaccine and challenge strain pairs. While some relationships were more pred...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:
Identifier Status Title NCT04927065 Active, not recruiting A Study to Evaluate the Immunogenicity and Safety of mRNA-12… Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
-
