High-affinity, neutralizing antibodies to SARS-CoV-2 can be made without T follicular helper cells

  1. Jennifer S. Chen
  2. Ryan D. Chow
  3. Eric Song
  4. Tianyang Mao
  5. Benjamin Israelow
  6. Kathy Kamath
  7. Joel Bozekowski
  8. Winston A. Haynes
  9. Renata B. Filler
  10. Bridget L. Menasche
  11. Jin Wei
  12. Mia Madel Alfajaro
  13. Wenzhi Song
  14. Lei Peng
  15. Lauren Carter
  16. Jason S. Weinstein
  17. Uthaman Gowthaman
  18. Sidi Chen
  19. Joe Craft
  20. John C. Shon
  21. Akiko Iwasaki
  22. Craig B. Wilen
  23. Stephanie C. Eisenbarth

Reviewed by

Read the full article See related articles

Listed in

Log in to save this article

Abstract

T follicular helper (T FH ) cells are the conventional drivers of protective, germinal center (GC)–based antiviral antibody responses. However, loss of T FH cells and GCs has been observed in patients with severe COVID-19. As T cell–B cell interactions and immunoglobulin class switching still occur in these patients, noncanonical pathways of antibody production may be operative during SARS-CoV-2 infection. We found that both T FH -dependent and -independent antibodies were induced against SARS-CoV-2 infection, SARS-CoV-2 vaccination, and influenza A virus infection. Although T FH -independent antibodies to SARS-CoV-2 had evidence of reduced somatic hypermutation, they were still high affinity, durable, and reactive against diverse spike-derived epitopes and were capable of neutralizing both homologous SARS-CoV-2 and the B.1.351 (beta) variant of concern. We found by epitope mapping and B cell receptor sequencing that T FH cells focused the B cell response, and therefore, in the absence of T FH cells, a more diverse clonal repertoire was maintained. These data support an alternative pathway for the induction of B cell responses during viral infection that enables effective, neutralizing antibody production to complement traditional GC-derived antibodies that might compensate for GCs damaged by viral inflammation.

Article activity feed

  1. Version published to 10.1126/sciimmunol.abl5652
  2. ScreenIT

    SciScore for 10.1101/2021.06.10.447982: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    EthicsIACUC: Animal use and care was approved in agreement with the Yale Animal Resource Center and Institutional Animal Care and Use Committee according to the standards set by the Animal Welfare Act.
    Euthanasia Agents: Mice were anesthetized by intraperitoneal injection of ketamine (50 mg/kg) and xylazine (5 mg/kg).
    Sex as a biological variableMice of both sexes between 6 and 10 weeks old were used for this study.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Cell Line AuthenticationContamination: All cell lines tested negative for Mycoplasma spp.

    Table 2: Resources

    Antibodies
    SentencesResources
    Antibody isotypes were detected with anti-mouse IgG-HRP (1013-05), anti-mouse IgG1-HRP (1073-05), anti-mouse IgG2b-HRP (1093-05), anti-mouse IgG2c-HRP (1077-05), or anti-mouse IgG3-HRP (1103-05) from Southern Biotech or anti-mouse IgM-HRP (550588) from BD Biosciences by incubating for 1 hr at room temperature.
    anti-mouse IgG-HRP
    suggested: None
    anti-mouse IgG1-HRP
    suggested: (Santa Cruz Biotechnology Cat# sc-2060, RRID:AB_631760)
    anti-mouse IgG2b-HRP
    suggested: None
    anti-mouse IgG2c-HRP
    suggested: (SouthernBiotech Cat# 1078-05, RRID:AB_2794462)
    anti-mouse IgG3-HRP
    suggested: (Santa Cruz Biotechnology Cat# sc-2972, RRID:AB_650512)
    anti-mouse IgM-HRP
    suggested: None
    Cells were stained with the following antibodies or viability dye for 30 min at 4°C: anti-CD4 (RM4-5), TCRβ (H57-597), PD-1 (RMP1-30), CD44 (IM7), PSGL-1 (2PH1), Ly6C (HK1.4), B220 (RA3-6B2), Fas (Jo2), GL7 (GL7), CD138 (281-2), and LIVE/DEAD™ Fixable Aqua (Thermo Fisher).
    anti-CD4
    suggested: None
    PD-1
    suggested: None
    CD44
    suggested: (US Biological Cat# S9111-30A, RRID:AB_2182848)
    PSGL-1
    suggested: None
    Ly6C
    suggested: None
    B220
    suggested: None
    GL7
    suggested: None
    CD138
    suggested: None
    Experimental Models: Cell Lines
    SentencesResources
    Viruses: SARS-CoV-2 P1 stock was generated by inoculating Huh7.5 cells with SARS-CoV-2 isolate USA-WA1/2020 (BEI Resources, NR-52281) at a MOI of 0.01 for three days.
    Huh7.5
    suggested: RRID:CVCL_7927)
    The P1 stock was then used to inoculate Vero-E6 cells, and the supernatant was harvested after three days at 50% cytopathic effect.
    Vero-E6
    suggested: None
    The spike sequence of the B.1.351 variant of concern was generated by introducing the following mutations: L18F, D80A, D215G, R246I, K417N, E484K, N501Y, and A701V. 293T cells were transfected with either spike plasmid, followed by inoculation with replication-deficient VSV expressing Renilla luciferase for 1 hour at 37°C (99).
    293T
    suggested: None
    Experimental Models: Organisms/Strains
    SentencesResources
    Mice: Bcl6fl/fl [B6.129S(FVB)-Bcl6tm1.1Dent/J (30)], Cd4Cre [B6.Cg-Tg(Cd4-cre)1Cwi/BfluJ (94)], Ciita−/− [B6.129S2-Ciitatm1Ccum/J (35)], K18-hACE2 [B6.Cg-Tg(K18-ACE2)2Prlmn/J (48)] were purchased from Jackson Laboratory.
    B6.129S(FVB)-Bcl6tm1.1Dent/J
    suggested: RRID:IMSR_JAX:023727)
    Cd4Cre
    suggested: None
    B6.Cg-Tg(Cd4-cre)1Cwi/BfluJ
    suggested: RRID:IMSR_JAX:022071)
    B6.129S2-Ciitatm1Ccum/J
    suggested: RRID:IMSR_JAX:003239)
    K18-hACE2 [B6.Cg-Tg(K18-ACE2)2Prlmn/J
    suggested: None
    K18-hACE2 mice were crossed with Bcl6fl/flCd4Cre mice to generate K18-hACE2 Bcl6fl/fl and Bcl6fl/flCd4Cre mice.
    K18-hACE2
    suggested: RRID:IMSR_GPT:T037657)
    K18-hACE2 Bcl6fl/fl and Bcl6fl/flCd4Cre mice were infected with 20 PFU of SARS-CoV-2.
    Bcl6fl/fl
    suggested: None
    Bcl6fl/flCd4Cre
    suggested: None
    Bcl6fl/fl, Bcl6fl/flCd4Cre, and Ciita−/− mice were infected with 70 PFU of PR8.
    Ciita−/−
    suggested: None
    Recombinant DNA
    SentencesResources
    Vector pCAGGS containing the SARS-CoV-2 Wuhan-Hu-1 spike glycoprotein gene was produced under HHSN272201400008C and obtained through BEI Resources (NR-52310).
    pCAGGS
    suggested: RRID:Addgene_18926)
    Software and Algorithms
    SentencesResources
    Samples were acquired on a CytoFLEX S (Beckman Coulter) and analyzed using FlowJo software (BD).
    FlowJo
    suggested: (FlowJo, RRID:SCR_008520)
    Images were acquired on a Nikon TiE Spinning Disk Confocal Microscope with the 30× objective and analyzed with ImageJ.
    ImageJ
    suggested: (ImageJ, RRID:SCR_003070)
    Quantitative PCR (qPCR) was performed in triplicate for samples and standards using SARS-CoV-2 nucleocapsid (N1)-specific oligonucleotides: Probe: 5’ 6FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3’; Forward primer: 5’GACCCCAAAATCAGCGAAAT-3’; Reverse primer: 5’ TCTGGTTACTGCCAGTTGAATCTG 3’.
    Probe
    suggested: (UniPROBE, RRID:SCR_005803)
    Differential enrichment analysis was performed using the Wald test in DESeq2, comparing Bcl6fl/fl vs Bcl6fl/flCd4Cre samples.
    DESeq2
    suggested: (DESeq, RRID:SCR_000154)
    Pan-human coronavirus (hCoV) conservation scores were calculated through multiple alignment of several hCoV spike sequences using Clustal Omega (105).
    Clustal Omega
    suggested: (Clustal Omega, RRID:SCR_001591)
    Statistical analysis: Data analysis was performed using GraphPad Prism 9 unless otherwise indicated.
    GraphPad Prism
    suggested: (GraphPad Prism, RRID:SCR_002798)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 30. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • No funding statement was detected.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  3. Version published to 10.1101/2021.06.10.447982v1 on bioRxiv