Further antibody escape by Omicron BA.4 and BA.5 from vaccine and BA.1 serum

  1. Aekkachai Tuekprakhon
  2. Jiandong Huo
  3. Rungtiwa Nutalai
  4. Aiste Dijokaite-Guraliuc
  5. Daming Zhou
  6. Helen M. Ginn
  7. Muneeswaran Selvaraj
  8. Chang Liu
  9. Alexander J. Mentzer
  10. Piyada Supasa
  11. Helen M.E. Duyvesteyn
  12. Raksha Das
  13. Donal Skelly
  14. Thomas G. Ritter
  15. Ali Amini
  16. Sagida Bibi
  17. Sandra Adele
  18. Sile Ann Johnson
  19. Bede Constantinides
  20. Hermione Webster
  21. Nigel Temperton
  22. Paul Klenerman
  23. Eleanor Barnes
  24. Susanna J. Dunachie
  25. Derrick Crook
  26. Andrew J Pollard
  27. Teresa Lambe
  28. Philip Goulder
  29. OPTIC consortium
  30. ISARIC4C consortium
  31. Elizabeth E. Fry
  32. Juthathip Mongkolsapaya
  33. Jingshan Ren
  34. David I. Stuart
  35. Gavin R Screaton

Reviewed by

Read the full article See related articles

Discuss this preprint

Start a discussion What are Sciety discussions?

Listed in

Log in to save this article

Abstract

The Omicron lineage of SARS-CoV-2, first described in November 2021, spread rapidly to become globally dominant and has split into a number of sub-lineages. BA.1 dominated the initial wave but has been replaced by BA.2 in many countries. Recent sequencing from South Africa’s Gauteng region uncovered two new sub-lineages, BA.4 and BA.5 which are taking over locally, driving a new wave. BA.4 and BA.5 contain identical spike sequences and, although closely related to BA.2, contain further mutations in the receptor binding domain of spike. Here, we study the neutralization of BA.4/5 using a range of vaccine and naturally immune serum and panels of monoclonal antibodies. BA.4/5 shows reduced neutralization by serum from triple AstraZeneca or Pfizer vaccinated individuals compared to BA.1 and BA.2. Furthermore, using serum from BA.1 vaccine breakthrough infections there are likewise, significant reductions in the neutralization of BA.4/5, raising the possibility of repeat Omicron infections.

Article activity feed

  1. ScreenIT

    SciScore for 10.1101/2022.05.21.492554: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    EthicsConsent: A blood sample was taken following consent at least 14 days after symptom onset.
    IRB: Sera from Beta, Gamma and Delta and BA.1 infected cases: Beta and Delta samples from UK infected cases were collected under the “Innate and adaptive immunity against SARS-CoV-2 in healthcare worker family and household members” protocol affiliated to the Gastro-intestinal illness in Oxford: COVID sub study discussed above and approved by the University of Oxford Central University Research Ethics Committee.
    Field Sample Permit: The study was approved by the Human Research Ethics Committee of the University of the Witwatersrand (reference number 200313) and conducted in accordance with Good Clinical Practice guidelines.
    IACUC: Gamma samples were provided by the International Reference Laboratory for Coronavirus at FIOCRUZ (WHO) as part of the national surveillance for coronavirus and had the approval of the FIOCRUZ ethical committee (CEP 4.128.241) to continuously receive and analyse samples of COVID-19 suspected cases for virological surveillance.
    Sex as a biological variableThe mean age of vaccinees was 37 years (range 22-66), 21 male and 35 female.
    RandomizationAstraZeneca-Oxford vaccine study procedures and sample processing: Full details of the randomized controlled trial of ChAdOx1 nCoV-19 (AZD1222), were previously published (PMID: 33220855/PMID: 32702298).
    Blindingnot detected.
    Power Analysisnot detected.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Experimental Models: Cell Lines
    SentencesResources
    EXPERIMENTAL MODEL AND SUBJECT DETAILS: Bacterial Strains and Cell Culture: Vero (ATCC CCL-81) and VeroE6/TMPRSS2 cells were cultured at 37 °C in Dulbecco’s Modified Eagle medium (DMEM) high glucose (Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS), 2 mM GlutaMAX (Gibco, 35050061) and 100rnU/ml of penicillin– streptomycin.
    Vero
    suggested: None
    VeroE6/TMPRSS2
    suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)
    HEK293T (ATCC CRL- 11268) cells were cultured in DMEM high glucose (Sigma-Aldrich) supplemented with 10% FBS, 1% 100X Mem Neaa (Gibco) and 1% 100X L-Glutamine (Gibco) at 37 °C with 5% CO2.
    HEK293T
    suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)
    Recombinant DNA
    SentencesResources
    The resulting S gene-carrying pcDNA3.1 was used for generating pseudoviral particles together with the lentiviral packaging vector and transfer vector encoding luciferase reporter.
    pcDNA3.1
    suggested: RRID:Addgene_79663)
    The gene fragment was amplified with pNeoRBD333Omi_F (5’- GGTTGCGTAGCTGAAACCGGTCATCACCATCACCATCACACCAATCTGTGCCCTTTCGAC-3’) and pNeoRBD333_R (5’-GTGATGGTGGTGCTTGGTACCTTATTACTTCTTGCCGCACACGGTAGC-3’), and cloned into the pNeo vector (Supasa et al., 2021).
    pNeo
    suggested: None
    To generate the BA.4/5 RBD construct containing a BAP- His tag, the gene fragment was amplified with RBD333_F (5’- GCGTAGCTGAAACCGGCACCAATCTGTGCCCTTTCGAC-3’) and RBD333_BAP_R (5’-GTCATTCAGCAAGCTCTTCTTGCCGCACACGGTAGC-3’), and cloned into the pOPINTTGneo-BAP vector (Huo et al., 2020a).
    pOPINTTGneo-BAP
    suggested: None
    To express biotinylated RBDs, the RBD-BAP plasmid was co-transfected with pDisplay-BirA-ER (Addgene plasmid 20856; coding for an ER-localized biotin ligase), in the presence of 0.8 mM D-biotin (Sigma-Aldrich).
    RBD-BAP
    suggested: None
    pDisplay-BirA-ER
    suggested: RRID:Addgene_20856)
    Software and Algorithms
    SentencesResources
    The sensorgrams were plotted using Prism9 (GraphPad).
    GraphPad
    suggested: (GraphPad Prism, RRID:SCR_002798)
    The percentage reduction was calculated and IC50 determined using the probit program from the SPSS package.
    SPSS
    suggested: (SPSS, RRID:SCR_002865)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: We found the following clinical trial numbers in your paper:

    IdentifierStatusTitle
    NCT04324606Active, not recruitingA Study of a Candidate COVID-19 Vaccine (COV001)
    NCT04400838Active, not recruitingInvestigating a Vaccine Against COVID-19

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: We did not find any issues relating to colormaps.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  2. Version published to 10.1101/2022.05.21.492554 on bioRxiv