The highly conserved stem-loop II motif is important for the lifecycle of astroviruses but dispensable for SARS-CoV-2

Article activity feed

1. 

   ScreenIT

   May 4, 2022

   SciScore for 10.1101/2022.04.30.486882: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Ethics	Field Sample Permit: SARS-CoV-2 reverse genetics system: All work with potentially infectious SARS-CoV-2 particles was conducted under enhanced biosafety level 3 (BSL-3) conditions and approved by the institutional biosafety committee of Washington University in St. Louis. IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381– 01).
   Sex as a biological variable	Five to six-week-old male hamsters were obtained from Charles River Laboratories and housed at Washington University.
   Randomization	Propagation of a clinical isolate of SARS-CoV-2 containing a deletion of the s2m: As part of ongoing …

   SciScore for 10.1101/2022.04.30.486882: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Ethics	Field Sample Permit: SARS-CoV-2 reverse genetics system: All work with potentially infectious SARS-CoV-2 particles was conducted under enhanced biosafety level 3 (BSL-3) conditions and approved by the institutional biosafety committee of Washington University in St. Louis. IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381– 01).
   Sex as a biological variable	Five to six-week-old male hamsters were obtained from Charles River Laboratories and housed at Washington University.
   Randomization	Propagation of a clinical isolate of SARS-CoV-2 containing a deletion of the s2m: As part of ongoing SARS-CoV-2 variant surveillance, a random set of RT-PCR positive respiratory secretions from the Barnes Jewish Hospital Clinical microbiology laboratory were subjected to whole genome sequencing using the ARTIC primer amplicon strategy 42.
   Blinding	not detected.
   Power Analysis	not detected.
   Cell Line Authentication	not detected.

   Table 2: Resources

   Experimental Models: Cell Lines
   Sentences	Resources
   Cell culture conditions: BHK-21, HEK293T and Caco-2 cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM) with L-glutamine (Gibco) supplemented with 10% fetal bovine serum (FBS) and 100 units/mL penicillin/streptomycin and incubated at 37°C and 5% CO2.	HEK293T suggested: None
   A total of 1.5 µg/well of VA1 IVT RNA was transfected into BHK-21 cells in 12-well plates using 3 µL/well of Lipofectamine MessengerMax (Invitrogen) and following the manufacturer’s protocol.	BHK-21 suggested: None
   After 3 freeze-thaw cycles, viral stocks were titrated using Caco-2 cells on 96-well plates in the absence of trypsin, enabling single-round infection 16.	Caco-2 suggested: None
   Huh7.5.1 and HEK293T cells were transfected in triplicate with HAstV1 replicon IVT RNA using Lipofectamine 2000 (Invitrogen), following a previously described protocol in which suspended cells are added directly to the RNA complexes in 96-well plates 7.	Huh7.5.1 suggested: RRID:CVCL_E049)
   SARS CoV-2 growth curves and titration assays: Vero-hTMPRSS2 and Calu-3 cells were grown to confluency.	Calu-3 suggested: KCLB Cat# 30055, RRID:CVCL_0609)
   This virus was expanded twice on Vero-hACE2-hTMPRSS2 cells and the virus titer was determined by plaque assay.	Vero-hACE2-hTMPRSS2 suggested: None
   Experimental Models: Organisms/Strains
   Sentences	Resources
   Vero cells expressing human TMPRSS2 (Vero-hTMPRSS2) 35 or human ACE2 and human TMPRSS2 (Vero-hACE2-hTMPRSS2, gift from Drs.	Vero-hACE2-hTMPRSS2 suggested: None
   Vero-hTMPRSS2 and Vero-hACE2-hTMPRSS2 cells were maintained by selection with 5 µg/mL Blasticidin or 10 µg/mL puromycin respectively.	Vero-hTMPRSS2 suggested: None
   Recombinant DNA
   Sentences	Resources
   Plasmid p1629 contains a BamHI restriction site, T7 promoter (TAATACGACTCACTATAG) followed by the first 1629 nucleotides of the VA1 genome inserted into the pSMART plasmid (Lucigen).	p1629 suggested: None pSMART suggested: RRID:Addgene_102283)
   A second plasmid, p5023 contains a BamHI and BlpI restriction site, nucleotides 1610-6586 followed by a poly-A sequence of 18 adenosines, followed by EciI and SbfI restriction digest sites inserted into pUC19.	pUC19 suggested: RRID:Addgene_50005)
   Wild-type and mutant p5023 plasmids were linearized using BamHI and BlpI.	p5023 suggested: None
   Human astrovirus 1 reverse genetics system: Mutant s2m sequences were introduced using site-directed mutagenesis of a previously published plasmid encoding HAstV1 (pAVIC1) 15 and confirmed by sequencing.	pAVIC1 suggested: None
   The pAVIC1- derived HAstV1 RNA was electroporated into BSR cells as previously described 16.	pAVIC1- suggested: None
   Fragments A and C-G were cloned into plasmid pUC57 vector and amplified in E.	pUC57 suggested: RRID:Addgene_40306)
   The bacteria toxic fragment B was cloned into low copy inducible BAC vector pCCI and amplified through plasmid induction in EPI300.	pCCI suggested: None
   The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences.	pUC57-SARS-CoV-2-N suggested: None
   Software and Algorithms
   Sentences	Resources
   Astrovirus VA1 reverse genetics system: The reference VA1 genome (NC_013060.1) was synthesized using gBlocks (Integrated DNA Technologies)36.	gBlocks suggested: (Gblocks, RRID:SCR_015945)
   The immunofluorescence-based detection with 0.26 µg/mL of 8E7 astrovirus antibody (Santa Cruz Biotechnolgy, sc-53559) was combined with infrared detection readout and automated LI-COR software-based quantification.	Santa Cruz Biotechnolgy suggested: None
   SARS-CoV-2 RNA levels were measured by one-step quantitative reverse transcriptase PCR (RT-qPCR) TaqMan assay as described previously using a SARS-CoV-2 nucleocapsid (N) specific primers/probe set from the Centers for Disease Control and Prevention (F primer: GACCCCAAAATCAGCGAAAT; R primer: TCTGGTTACTGCCAGTTGAATCTG; probe: 5′-FAM/ACCCCGCATTACGTTTGGTGGACC/3′-ZEN/IBFQ)40.	GACCCCAAAATCAGCGAAAT suggested: None
   The P2 of WUSTL_000226_A131/2021 was sequenced by NGS to confirm the presence of the s2m deletion and rule out any tissue culture adaptations in the rest of the genome.	NGS suggested: (ANGSD, RRID:SCR_021865)
   In brief, Illumina sequencing data were filtered using fastp (https://github.com/OpenGene/fastp) trimming bases with a Phred quality score ≥Q30.	https://github.com/OpenGene/fastp suggested: (fastp, RRID:SCR_016962) Phred suggested: (Phred, RRID:SCR_001017)
   High-quality reads were then aligned to the SARS-CoV-2 reference genome sequence (NC_045512.2) using BWA 45.	BWA suggested: (BWA, RRID:SCR_010910)
   SAMtools was used to sort, index and remove duplicates from bam files, and local realignment and variant calling were achieved by LoFreq to generate the mutant report file 46.	SAMtools suggested: (SAMTOOLS, RRID:SCR_002105) LoFreq suggested: (LoFreq, RRID:SCR_013054)
   Sequences were visualized using Jalview 2 48.	Jalview suggested: (Jalview, RRID:SCR_006459)
   Statistical analysis: Data was graphed using Prism 9.3.1 (GraphPad).	Prism suggested: (PRISM, RRID:SCR_005375) GraphPad suggested: (GraphPad Prism, RRID:SCR_002798)

   ---

   Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

   ---

   Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

   ---

   Results from TrialIdentifier: No clinical trial numbers were referenced.

   ---

   Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

   ---

   Results from JetFighter: We did not find any issues relating to colormaps.

   ---

   Results from rtransparent:

   • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
   • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
   • No protocol registration statement was detected.

   ---

   Results from scite Reference Check: We found no unreliable references.

   ---

   Read the original source
2. 

   Version published to 10.1101/2022.04.30.486882 on bioRxiv

   May 2, 2022