Nasally-delivered interferon-λ protects mice against upper and lower respiratory tract infection of SARS-CoV-2 variants including Omicron

  1. Zhenlu Chong
  2. Courtney E. Karl
  3. Peter J. Halfmann
  4. Yoshihiro Kawaoka
  5. Emma S. Winkler
  6. Jinsheng Yu
  7. Michael S. Diamond

Reviewed by

Read the full article See related articles

Listed in

Log in to save this article

Abstract

Although vaccines and monoclonal antibody countermeasures have reduced the morbidity and mortality associated with SARS-CoV-2 infection, variants with constellations of mutations in the spike gene threaten their efficacy. Accordingly, antiviral interventions that are resistant to further virus evolution are needed. The host-derived cytokine IFN-λ has been proposed as a possible treatment based on correlative studies in human COVID-19 patients. Here, we show IFN-λ protects against SARS-CoV-2 B.1.351 (Beta) and B.1.1.529 (Omicron)variants in three strains of conventional and human ACE2 transgenic mice. Prophylaxis or therapy with nasally-delivered IFN-λ2 limited infection of historical or variant (B.1.351 and B.1.1.529) SARS-CoV-2 strains in the upper and lower respiratory tracts without causing excessive inflammation. In the lung, IFN-λ was produced preferentially in epithelial cells and acted on radio-resistant cells to protect against of SARS-CoV-2 infection. Thus, inhaled IFN-λ may have promise as a treatment for evolving SARS-CoV-2 variants that develop resistance to antibody-based countermeasures.

Article activity feed

  1. Rapid Reviews Infectious Diseases

    Review 2: "Nasally-delivered interferon-λ protects mice against upper and lower respiratory tract infection of SARS-CoV-2 variants including Omicron"

    This preprint examines the role of interferon-λ (IFN-L) in providing protection against COVID-19 using mouse model systems. Reviewers found the main claims of the paper reliable, with findings informative for future evaluation of IFN-L treatment’s efficacy in COVID-19 patients.

  2. Rapid Reviews Infectious Diseases

    Azam Roohi

    Review 1: "Nasally-delivered interferon-λ protects mice against upper and lower respiratory tract infection of SARS-CoV-2 variants including Omicron"

    This preprint examines the role of interferon-λ (IFN-L) in providing protection against COVID-19 using mouse model systems. Reviewers found the main claims of the paper reliable, with findings informative for future evaluation of IFN-L treatment’s efficacy in COVID-19 patients.

  4. ScreenIT

    SciScore for 10.1101/2022.01.21.477296: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    Ethicsnot detected.
    Sex as a biological variableFor bone marrow chimeric mice, six-week-old male and female WT (CD45.1) and Ifnlr1-/- (CD45.2) recipient mice were irradiated with 9 Gy (X-ray) total body irradiation (TBI).
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Antibodies
    SentencesResources
    Cells were incubated with antibodies against the following markers: BV421 anti-CD45, AF700 anti-Ly6C, FITC anti-Ly6B, PE-CY7 anti-Ly6G and APC anti-CD11b.
    anti-CD45
    suggested: (SouthernBiotech Cat# 1660-27, RRID:AB_2795109)
    anti-Ly6C , FITC
    suggested: None
    PE-CY7
    suggested: (Fitzgerald Industries International Cat# 61R-CD11aaMSPE7, RRID:AB_1282980)
    anti-Ly6G
    suggested: None
    anti-CD11b
    suggested: None
    AF-700 anti-MHC II (I-A/I-E), BV421 anti-CD3, PE anti-CD19, APC anti-CD11b, PE anti-CD326 and PE anti-Ly6C antibodies as described above.
    anti-MHC II ( I-A/I-E)
    suggested: (Thermo Fisher Scientific Cat# 36-5321-85, RRID:AB_529608)
    BV421
    suggested: None
    anti-CD3
    suggested: None
    anti-CD19
    suggested: None
    anti-CD11b , PE
    suggested: (Abcam Cat# ab25506, RRID:AB_470594)
    anti-Ly6C
    suggested: None
    , rabbit anti-nucleocapsid protein (1: 500), and chicken anti-GFP (1: 1000) primary antibodies at 4[ overnight.
    rabbit anti-nucleocapsid protein ( 1: 500)
    suggested: None
    chicken anti-GFP ( 1: 1000 ) primary antibodies at 4 [ overnight
    suggested: None
    anti-GFP
    suggested: None
    , donkey anti-rabbit (1: 500) and donkey anti-rat (1: 500) secondary antibodies for 1 h at room temperature and with Hoechst dye (1:10000) for 5 min.
    anti-rabbit
    suggested: None
    anti-rat
    suggested: None
    Experimental Models: Cell Lines
    SentencesResources
    Plaque assay: Vero-TMPRSS2-ACE2 cells were seeded at a density of 1.25 x 105 cells per well in flat-bottom 24-well tissue culture plates.
    Vero-TMPRSS2-ACE2
    suggested: None
    Experimental Models: Organisms/Strains
    SentencesResources
    Homogenates were analyzed for cytokines and chemokines by Eve Technologies Corporation (Calgary, AB, Canada) using their Mouse Cytokine Array/Chemokine Array 31-Plex (MD31) platform.
    AB
    suggested: None
    Software and Algorithms
    SentencesResources
    Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/).
    GACTGCCGCCTCTGCTC
    suggested: None
    Probe
    suggested: (UniPROBE, RRID:SCR_005803)
    RNA-seq reads were aligned to the mouse Ensembl GRCh38.76 primary assembly with STAR program (version 2.5.1a) (Dobin et al., 2013)
    STAR
    suggested: (STAR, RRID:SCR_004463)
    The ribosomal fraction, known junction saturation, and read distribution over known gene models were quantified with RSeQC (version 2.6.2) (Liao et al., 2014).
    RSeQC
    suggested: (RSeQC, RRID:SCR_005275)
    All gene counts were preprocessed with the R package EdgeR (Robinson et al., 2010) to adjust samples for differences in library size using the trimmed mean of M values (TMM) normalization procedure.
    EdgeR
    suggested: (edgeR, RRID:SCR_012802)
    The R package limma (Ritchie et al., 2015) with voomWithQualityWeights function (Liu et al., 2015) was utilized to calculate the weighted likelihoods for all samples, based on the observed mean-variance relationship of every gene and sample.
    limma
    suggested: (LIMMA, RRID:SCR_010943)

    Results from OddPub: Thank you for sharing your data.

    Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
    One group tried to overcome this limitation by administering type I IFN by an intranasal route; in hamsters, they showed that nasally-delivered type I IFN could reduce viral burden, prevent virus transmission, and lower inflammation in vivo (Hoagland et al., 2021). In our mouse models, administration of IFN-λ protected mice from infection, weight loss, lung inflammation, and lung disease, suggesting that the less pro-inflammatory nature of IFN-λ (Lazear et al., 2019) may have advantages as a therapeutic strategy. Our RNA sequencing data also showed IFN-λ treatment induced a tissue repair transcriptional signature in the lung, which contrasts with some studies showing that persistent type I or type III IFN signaling can disrupt lung epithelial barriers and prevent tissue repair (Broggi et al., 2020a; Major et al., 2020). Nonetheless, administration of IFN-λ later in the course of SARS-CoV-2 infection, when most of the disease is caused by the host response and not by viral replication, could be detrimental and warrants further study. By leveraging flow cytometry, qRT-PCR, and Ifnl2-gfp reporter mice, we found that IFN-λ was produced mainly from lung ECs after SARS-CoV-2 infection. This observation agrees with experiments by others after influenza A virus infection (Galani et al., 2017). We also showed IFN-λ acted primarily on radio-resistant cells in the lung to confer protection against SARS-CoV-2 infection, which is consistent with a recent finding (Broggi et al., 2020a). Wh...

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 47. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  5. Version published to 10.1101/2022.01.21.477296v1 on bioRxiv