Variable loss of antibody potency against SARS-CoV-2 B.1.1.529 (Omicron)

  1. Daniel J. Sheward
  2. Changil Kim
  3. Roy A. Ehling
  4. Alec Pankow
  5. Xaquin Castro Dopico
  6. Darren Martin
  7. Sai Reddy
  8. Joakim Dillner
  9. Gunilla B. Karlsson Hedestam
  10. Jan Albert
  11. Ben Murrell

Reviewed by

Read the full article

Listed in

Log in to save this article

Abstract

The recently-emerged SARS-CoV-2 B.1.1.529 variant (Omicron) is spreading rapidly in many countries, with a spike that is highly diverged from the pandemic founder, raising fears that it may evade neutralizing antibody responses. We cloned the Omicron spike from a diagnostic sample which allowed us to rapidly establish an Omicron pseudotyped virus neutralization assay, sharing initial neutralization results only 13 days after the variant was first reported to the WHO, 8 days after receiving the sample.

Here we show that Omicron is substantially resistant to neutralization by several monoclonal antibodies that form part of clinical cocktails. Further, we find neutralizing antibody responses in pooled reference sera sampled shortly after infection or vaccination are substantially less potent against Omicron, with neutralizing antibody titers reduced by up to 45 fold compared to those for the pandemic founder. Similarly, in a cohort of convalescent sera prior to vaccination, neutralization of Omicron was low to undetectable. However, in recent samples from two cohorts from Stockholm, Sweden, antibody responses capable of cross-neutralizing Omicron were prevalent. Sera from infected-then-vaccinated healthcare workers exhibited robust cross-neutralization of Omicron, with an average potency reduction of only 5-fold relative to the pandemic founder variant, and some donors showing no loss at all. A similar pattern was observed in randomly sampled recent blood donors, with an average 7-fold loss of potency. Both cohorts showed substantial between-donor heterogeneity in their ability to neutralize Omicron. Together, these data highlight the extensive but incomplete evasion of neutralizing antibody responses by the Omicron variant, and suggest that increasing the magnitude of neutralizing antibody responses by boosting with unmodified vaccines may suffice to raise titers to levels that are protective.

Article activity feed

  1. ScreenIT

    SciScore for 10.1101/2021.12.19.473354: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    EthicsConsent: Ethics statement: HW and Convalescent cohorts: Informed consent was obtained from all participants as part of an ethics approval (Decision number 2020-01620, with amendments 2020-02881 and 2020-05630) from the Swedish Ethical Review Authority.
    Sex as a biological variablenot detected.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Experimental Models: Cell Lines
    SentencesResources
    Cloned Omicron Spike coding sequence (with 19AA CT truncation): Cell culture: HEK293T cells (ATCC CRL-3216) and HEK293T-ACE2 cells (stably expressing human ACE2) were cultured in Dulbecco’s Modified Eagle Medium (high glucose, with sodium pyruvate) supplemented with 10% fetal calf serum, 100 units/ml Penicillin, and 100 μg/ml Streptomycin.
    HEK293T
    suggested: None
    Neutralization was assessed in HEK293T-ACE2 cells.
    HEK293T-ACE2
    suggested: None
    Expi293 cells were transfected with plasmids encoding for the heavy and light chain at 1µg/mL (i.e. 0.5µg/mL each) according to the manufacturer’s instructions (ThermoFisher, manual for Cat#A14525).
    Expi293
    suggested: RRID:CVCL_D615)
    Recombinant DNA
    SentencesResources
    Primers (5’-3’) used for the construction of the Omicron Spike expression plasmid Spike PCR: First round (primers from 21): SARSCoV1200_22_LEFT GTGATGTTCTTGTTAACAACTAAACGAACA SARSCoV1200_24_RIGHT ATGAGGTGCTGACTGAGGGAAG Second round: FWD_N_term_sample CAAGGTGTTCAGATCCTCAGTTTTACATTCAACTC REV_C_term_sample TCTGCAGTCTGCCTGTGATCAACCTATCAATTTGC N-terminus flank PCR: Fwd_CMV_plasmid ACGCAAATGGGCGGTAGGCGTG REV_N_term_plasmid TGAATGTAAAACTGAGGATCTGAACACCTTGTCGG C-terminus flank PCR: FWD_C_term_plasmid AAATTGATAGGTTGATCACAGGCAGACTGCAGAGC Rev_plasmid TGGCAACTAGAAGGCACAGTCGAG The three PCR products were cloned by Gibson Assembly into a restriction-enzyme (NheI and XbaI) digested, codon-optimized SARS-CoV-2 Spike expression vector (in pcDNA3.1) harbouring a mutation that introduces a stop codon that truncates the last 19 amino acids of the cytoplasmic tail (facilitating efficient incorporation onto lentiviral particles).
    pcDNA3.1
    suggested: RRID:Addgene_79663)
    Monoclonal antibody production: Antibody sequences were extracted from deposited RCSB entries and codon optimized (using a human germline-aware codon optimization strategy), then synthesized as gene fragments and cloned into pTWIST transient expression vectors by Gibson assembly or restriction cloning (NotI, BamHI)
    pTWIST
    suggested: RRID:Addgene_164438)
    Software and Algorithms
    SentencesResources
    Statistical analysis: Individual ID50 values for each sample against each variant were calculated in Prism v9 (GraphPad Software) by fitting a four-parameter logistic curve, to neutralization by serial 3-fold dilutions of serum.
    Prism
    suggested: (PRISM, RRID:SCR_005375)
    GraphPad
    suggested: (GraphPad Prism, RRID:SCR_002798)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: We did not find any issues relating to colormaps.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  2. Version published to 10.1101/2021.12.19.473354v1 on bioRxiv