SARS-CoV-2 Spike protein activates TMEM16F-mediated platelet pro-coagulant activity

  1. Ambra Cappelletto
  2. Harriet E. Allan
  3. Marilena Crescente
  4. Edoardo Schneider
  5. Rossana Bussani
  6. Hashim Ali
  7. Ilaria Secco
  8. Simone Vodret
  9. Roberto Simeone
  10. Luca Mascaretti
  11. Serena Zacchigna
  12. Timothy D. Warner
  13. Mauro Giacca

Reviewed by

Read the full article

Listed in

Log in to save this article

Abstract

Background

Thrombosis of the lung micro-vasculature is a characteristic of COVID-19 disease, which is observed in large excess compared to other forms of acute respiratory distress syndrome and thus suggests a trigger for thrombosis endogenous to the lung. Our recent work has shown that the SARS-CoV-2 Spike protein activates the cellular TMEM16F chloride channel and scramblase. Through a screening on >3,000 FDA/EMA approved drugs, we identified Niclosamide and Clofazimine as the most effective molecules at inhibiting this activity. As TMEM16F plays an important role in the stimulation of the pro-coagulant activity of platelets, and considering that platelet abnormalities are common in COVID-19 patients, we investigated whether Spike directly affects platelet activation and pro-thrombotic function and tested the effect of Niclosamide and Clofazimine on these processes.

Methods

We produced SARS-CoV-2 Spike or VSV-G protein-pseudotyped virions, or generated cells expressing Spike on their plasma membrane, and tested their effects on platelet adhesion (fluorescence), aggregation (absorbance), exposure of phosphatidylserine (flow cytometry for annexin V binding), calcium flux (flow cytometry for fluo-4 AM), and clot formation and retraction. These experiments were also conducted in the presence of the TMEM16F activity inhibitors Niclosamide and Clofazimine.

Results

Here we show that exposure to SARS-CoV-2 Spike promotes platelet activation, adhesion and spreading, both when present on the envelope of virions or upon expression on the plasma membrane of cells. Spike was effective both as a sole agonist or by enhancing the effect of known platelet activators, such as collagen and collagen-related peptide. In particular, Spike exerted a noticeable effect on the procoagulant phenotype of platelets, by enhancing calcium flux, phosphatidylserine externalisation, and thrombin generation. Eventually, this resulted in a striking increase in thrombin-induced clot formation and retraction. Both Niclosamide and Clofazimine almost abolished this Spike-induced pro-coagulant response.

Conclusions

Together, these findings provide a pathogenic mechanism to explain thrombosis associated to COVID-19 lung disease, by which Spike present in SARS-CoV-2 virions or exposed on the surface of infected cells, leads to local platelet stimulation and subsequent activation of the coagulation cascade. As platelet TMEM16F is central in this process, these findings reinforce the rationale of repurposing drugs targeting this protein, such as Niclosamide, for COVID-19 therapy.

Article activity feed

  1. ScreenIT

    SciScore for 10.1101/2021.12.14.472668: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    EthicsField Sample Permit: Human blood collection and isolation of platelets: Platelet studies using human samples were conducted according to the principles of the Declaration of Helsinki and approved by St Thomas’s Hospital, London, UK Research Ethics Committee (Ref. 07/Q0702/24).
    IRB: Human blood collection and isolation of platelets: Platelet studies using human samples were conducted according to the principles of the Declaration of Helsinki and approved by St Thomas’s Hospital, London, UK Research Ethics Committee (Ref. 07/Q0702/24).
    Consent: All volunteers were screened prior to entering the study and gave written informed consent.
    Sex as a biological variableOf these, 25 were male and 16 were female; the average age was 77 for men and 84 for women.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Antibodies
    SentencesResources
    After washing 3 times with PBS, the plate was permeabilized with 0.5% Triton (Sigma) for 10 min, blocked with 1% BSA for 1 hr at room temperature (RT) and stained with anti-GFP antibody (1:1000; Abeam #ab6556) or anti-V5 tag antibody (1:500; Invitrogen #37-7500) for 2 hr at RT, and Cell Mask (1:2000; Thermo Fisher Scientific) for 30 min at RT.
    anti-V5
    suggested: (SICGEN Cat# AB0096, RRID:AB_2333109)
    Blots were then incubated (4°C overnight) with primary antibodies against Spike, tubulin or TMEM16F.
    antibodies against Spike, tubulin
    suggested: None
    Membranes were incubated for 1 hr at room temperature with anti-rabbit HRP-conjugated antibody (1:5,000) or anti-mouse HRP-conjugated antibody (1:10,000).
    anti-rabbit
    suggested: None
    anti-mouse
    suggested: None
    Antibodies: Immunofluorescence analysis was performed for actin (AlexaFluor 488 Phalloidin, A12379, ThermoFisher Scientific) and GFP (ab6556, Abcam).
    actin
    suggested: None
    GFP
    suggested: (Abcam Cat# ab6556, RRID:AB_305564)
    Immunoblots were performed with primary antibodies against Spike (Genetex, #GTX632604; 1:1,000), tubulin (Cell Signaling, #3873S; 1:10,000) and TMEM16F (Sigma-Aldrich, #HPA038958; 1:1,000).
    antibodies against Spike (Genetex,
    suggested: None
    , tubulin (Cell Signaling,
    suggested: (Cell Signaling Technology Cat# 86298, RRID:AB_2715541)
    Experimental Models: Cell Lines
    SentencesResources
    Pseudotyped viral particles were produced as follows: HEK293T cell (2.5 × 106) were seeded in a 100 mm-dish and co-transfected by calcium phosphate with 10 μg pLVTHM/GFP (Addgene 12247), 7.5 μg psPAX2 (Addgene 12260), and 6 μg pMD2.G (Addgene 12259) or pEC120-S-D19-V5, for a total of 13.5 μg DNA for each dish.
    HEK293T
    suggested: None
    To assess pseudoparticle infectivity, HEK-293T cells were bulk transfected with a plasmid expressing human ACE2 and then seeded in a 96-well plate (3×103 cells per well).
    HEK-293T
    suggested: None
    For platelet aggregation on Spike-expressing cells, Vero cells were kept in culture in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% of foetal bovine serum (FBS) and transfected using FuGENE HD (Promega) transfectant reagent as suggested by the manufacturer either with a plasmid encoding the Green Fluorescent Protein (GFP; pZac-GFP) or a plasmid encoding the full-length SARS-CoV-2 Spike protein with V5 tag (pSARS-COV-2-S).
    Vero
    suggested: None
    Recombinant DNA
    SentencesResources
    The modified DNA segment was obtained by recombinant PCR using primers Fw 5’ ACGCGTCGACTTTTGTGGCAAAGGTT, Re 5’ CCCAAGCTTGGGACGCGTCGTTACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCACCACCTCCACCGCAGCATGATCCGCATGAGC and cloned into the pEC117-Spike-V5 vector33.
    pEC117-Spike-V5
    suggested: None
    Pseudotyped viral particles were produced as follows: HEK293T cell (2.5 × 106) were seeded in a 100 mm-dish and co-transfected by calcium phosphate with 10 μg pLVTHM/GFP (Addgene 12247), 7.5 μg psPAX2 (Addgene 12260), and 6 μg pMD2.G (Addgene 12259) or pEC120-S-D19-V5, for a total of 13.5 μg DNA for each dish.
    pLVTHM/GFP
    suggested: None
    psPAX2
    suggested: RRID:Addgene_12260)
    pMD2.G
    suggested: RRID:Addgene_12259)
    pEC120-S-D19-V5
    suggested: None
    Briefly, PRP was incubated with VSV-G or Spike pseudoparticles (1:10) for 10 min at 37°C, followed by stimulation with collagen (30 μg/ml) for 20 min (350 rpm, 37°C).
    VSV-G
    suggested: RRID:Addgene_138479)
    Software and Algorithms
    SentencesResources
    Analysis was performed using the ImageJ software (Fiji).
    Fiji
    suggested: (Fiji, RRID:SCR_002285)
    Analysis was performed using ImageJ software (Fiji).
    ImageJ
    suggested: (ImageJ, RRID:SCR_003070)
    Analysis was performed using the FlowJo software v.10 (TreeStar Inc).
    FlowJo
    suggested: (FlowJo, RRID:SCR_008520)
    PRP was incubated with VSV-G (1:10), Spike pseudoparticles (1:10), His-tag recombinant SARS-CoV-2 Spike Protein S1/S2 (S-ECD) (1 ng/ml; ThermoFisher Scientific; aa11-1208; RP-87680) or Flag-tag recombinant SARS-CoV-2 Spike RBD (1 ng/ml; Bio-Techne, 10689-CV-100) for 10 min at 37°C, followed by stimulation with thrombin (0.5 units).
    ThermoFisher Scientific
    suggested: None

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: We did not find any issues relating to colormaps.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  2. Version published to 10.1101/2021.12.14.472668v2 on bioRxiv
  3. Version published to 10.1101/2021.12.14.472668v1 on bioRxiv