Development and Characterization of Recombinant Vesicular Stomatitis Virus (rVSV)-based Bivalent Vaccine Against COVID-19 Delta Variant and Influenza Virus

  1. Zhujun Ao
  2. Maggie Jing Ouyang
  3. Titus Abiola Olukitibi
  4. Bryce Warner
  5. Robert Vendramelli
  6. Thang Truong
  7. Manli Zhang
  8. Sam Kung
  9. Keith R Fowke
  10. Darwyn Kobasa
  11. Xiaojian Yao

Reviewed by

Read the full article See related articles

Discuss this preprint

Start a discussion What are Sciety discussions?

Listed in

Log in to save this article

Abstract

COVID-19 and influenza are both highly contagious respiratory diseases with a wide range of severe symptoms and cause great disease burdens globally. It has become very urgent and important to develop a bivalent vaccine that is able to target these two infectious diseases simultaneously. In this study, we generated three attenuated replicating recombinant VSV (rVSV) vaccine candidates. These rVSV-based vaccines co-express SARS-CoV-2 Delta variant spike protein (SP) or the receptor binding domain (RBD) and four copies of the highly conserved M2 ectodomain (M2e) of influenza A fused with the Ebola glycoprotein DC-targeting/activation domain. Animal studies have shown that immunization with these bivalent rVSV vaccines induced efficient but variable levels of humoral and cell-mediated immune responses against both SARS-CoV-2 and influenza M2e protein. Significantly, our vaccine candidates induced production of high levels of neutralizing antibodies that protected cells against SARS-CoV-2 Delta and other SP-pseudovirus infections in culture. Furthermore, vaccination with the bivalent VSV vaccine via either intramuscular or intranasal route efficiently protected mice from the lethal challenge of H1N1 and H3N2 influenza viruses and significantly reduced viral load in the lungs. These studies provide convincing evidence for the high efficacy of this bivalent vaccine to prevent influenza replication and initiate robust immune responses against SARS-CoV-2 Delta variants. Further investigation of its efficacy to protect against SARS-CoV-2 Delta variants will provide substantial evidence for new avenues to control two contagious respiratory infections, COVID-19 and influenza.

Article activity feed

  1. ScreenIT

    SciScore for 10.1101/2021.12.14.472657: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    Ethicsnot detected.
    Sex as a biological variablenot detected.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Cell Line AuthenticationAuthentication: To examine the growth kinetics of bivalent rVSV, cell lines were grown to confluency in a 24-well plate and infected in duplicate with VSVwt, V-EM2e/SPΔC1, rV-EM2e/SPΔC2 or V-EM2e/ERBD at a dose of 100 TCID50.

    Table 2: Resources

    Antibodies
    SentencesResources
    The antibodies used in the study included the rabbit polyclonal antibody against SARS-CoV-2 SP/RBD (Cat# 40150-R007, Sino Biological), anti-SARS-CoV-2 S-NTD antibody (E-AB-V1030, Elabscience)
    SARS-CoV-2
    suggested: (Sino Biological Cat# 40150-R007, RRID:AB_2827979)
    SP/RBD
    suggested: None
    anti-SARS-CoV-2 S-NTD
    suggested: None
    anti-M2 monoclonal antibody (14C2: sc-32238, Santa Cruz Biotech.), and anti-VSV-Nucleoprotein, clone 10G4 (Cat# MBAF2348
    anti-M2
    suggested: None
    anti-M2 monoclonal antibody ( 14C2: sc-32238 , Santa Cruz Biotech . )
    suggested: None
    anti-VSV-Nucleoprotein
    suggested: None
    To detect the expression of EM2, Delta SPΔC, RBD, and other viral proteins in cells, rVSV-infected cells were lysed and analyzed by SDS–PAGE and WB with anti-M2e (14C2), anti-SARS-CoV-2-RBD, or anti-VSV N antibodies.
    EM2
    suggested: (Gu, 502:701, 2007 Cat# EM-2 (endomorphin, RRID:AB_2314365)
    anti-M2e
    suggested: None
    anti-SARS-CoV-2-RBD
    suggested: None
    anti-VSV N
    suggested: None
    Enzyme-linked Immunosorbent Assay (ELISA) for measurement of anti-SARS-CoV-2-SP/RBD or anti-influenza M2e antibody levels in immunized mouse sera: Anti-SARS-CoV-2-SP/RBD antibodies and anti-influenza M2 antibodies in mouse sera were determined by ELISA, as previously described with some modifications 21.
    anti-influenza M2e
    suggested: None
    Anti-SARS-CoV-2-SP/RBD
    suggested: None
    anti-influenza
    suggested: None
    Experimental Models: Cell Lines
    SentencesResources
    Cells, antibodies, chemicals and viruses: A human embryonic kidney cell line (HEK293T), a human lung type II pulmonary epithelial cell line (A549), a human fetal lung fibroblast cell line (MRC-5), a human glioblastoma-derived cell line (U251GM), VeroE6 and MDCK cell line were cultured in Dulbecco’s modified Eagle’s medium, minimum essential medium (MEM) or DMEM/F-12 medium (21331-020, Gibco)
    MRC-5
    suggested: None
    MDCK
    suggested: None
    CD4+ Jurkat cells were cultured in RPMI-1640 medium.
    Jurkat
    suggested: None
    Immunofluorescence assay and syncytia formation assay: As previously described 21, Vero E6 cells were grown on glass coverslips (12 mm2) in 24-well plates and infected with V-EM2e/SPΔC1, V-EM2e/SPΔC2 or V-EM2e/ERBD for 48 hours.
    Vero E6
    suggested: None
    To test SARS-CoV-2 SPDelta-mediated syncytia formation, 293T cells were transfected with various SPΔC plasmids using Lipofectamine 2000.
    293T
    suggested: None
    After 24 hrs, the cells were washed, resuspended and mixed with A549ACE2 cells at a 1:3 ratio and plated into 12-well plates.
    A549ACE2
    suggested: None
    The supernatants were harvested at 72 h post-transfection, passed through a 0.45 μm filter, aliquoted and titrated on A549 cells expressing human ACE2 (A549/hACE2).
    A549
    suggested: None
    The pseudovirus neutralization assay was performed on A549/hACE2 cells according to previously reported methods with some modifications 50, 51.
    A549/hACE2
    suggested: None
    Experimental Models: Organisms/Strains
    SentencesResources
    Mouse immunization and viral challenge: Female BALB/c mice aged 4–6 weeks used in this study were obtained from the Central Animal Care Facility, University of Manitoba (with animal study protocol approval No. 20-034).
    BALB/c
    suggested: None
    Recombinant DNA
    SentencesResources
    Plasmid constructions: In this study, the gene encoding SPΔCDelta was amplified from the previously described plasmid pCAGGS-SPΔCDelta 32, and the I742A mutation was introduced by site-directed mutagenesis technique with, 5’-primers 5_TGTACAATGTATGCATGCGGAGACAGC, and 3’-primer, 5_GCTGTCTCCGCATGCATACATTGTACA.
    pCAGGS-SPΔCDelta 32
    suggested: None
    To construct rVSV-EM2e/SPΔC2, we used a two-step PCR technique to generate cDNA that carried an additional 381 aa deletion in the S2 region of SPΔCDelta (Fig. 1A, b), and the amplified SPΔC2-encoding cDNA was also cloned into the rVSV-EΔM-M2e vector using the same restriction enzymes, yielding rVSV-EM2e/SPΔC2.
    rVSV-EΔM-M2e
    suggested: None
    To construct rVSV-EM2e/ERBD, a cDNA fragment encoding the receptor binding domain (RBD) of SARS-CoV-2 (Wuhan-Hu-1, GenBank accession No. MN908947) spike protein was amplified from a pCAGGS-nCoVSP plasmid 31 and inserted in pCAGGS-EboGPΔM at the MLD region 21.
    pCAGGS-nCoVSP
    suggested: None
    pCAGGS-EboGPΔM
    suggested: None
    Then, the EboGPΔM-RBD cDNA (Fig. 1A, d) was cloned into the XhoI and NheI sites of the rVSV-EΔM-EM2e vector and named rVSV-EM2e/ERBD (Fig. 1B).
    rVSV-EΔM-EM2e
    suggested: None
    To construct pCAGGS-SPΔCBeta’ and pCAGGS-SPΔCB.1.617, the mutations K417N, E484K, N501Y and D614G (for SPΔCBeta’) and L452R, E484Q and D614G (for SPΔCB.1.617) were introduced into the pCAGGS-nCoVSPΔC plasmid 32 by site-directed mutagenesis.
    pCAGGS-SPΔCBeta’
    suggested: None
    pCAGGS-SPΔCB.1.617
    suggested: None
    pCAGGS-nCoVSPΔC
    suggested: None
    Virus production and infection experiments: SARS-CoV-2 SPΔC-PVs (SPΔCwt-, SPΔCDelta-, SPΔCDelta-a742-PVs) were produced by co-transfecting 293T cells with each of the pCAGGS-SPΔC plasmids, pCMVΔ8.2 and Gluc expressing HIV vector ΔRI/E/Gluc 31.
    pCAGGS-SPΔC
    suggested: None
    pCMVΔ8.2
    suggested: None
    Different SARS-CoV-2 SP pseudoviruss expressing luciferase were prepared and titrated as follows: HIV-based SARS-CoV-2 SP pseudoviruses (PVs) expressing luciferase (Luc) were produced by co-transfection of 293T cells with an HIV vector (pNL4-3-R-E-Luc) 37 and each pCAGGS-SPΔC or pCAGGS-VSV-G plasmid by using polyetherimide (PEI) transfection in a 6-well plate.
    pNL4-3-R-E-Luc
    suggested: None
    pCAGGS-VSV-G
    suggested: None
    Software and Algorithms
    SentencesResources
    The endpoint titer is designated as the reciprocal of the highest dilution of a serum that has an OD450 above the cutoff (10× negative control) and is calculated by using sigmoid 4PL interpolation with GraphPad Prism 9.0.
    GraphPad Prism
    suggested: (GraphPad Prism, RRID:SCR_002798)
    Statistics: Statistical analysis of antibody/cytokine levels was performed using the unpaired t test (considered significant at P≥0.05) by GraphPad Prism 5.01 software.
    GraphPad
    suggested: (GraphPad Prism, RRID:SCR_002798)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: We did not find any issues relating to colormaps.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  2. Version published to 10.1101/2021.12.14.472657 on bioRxiv