Production and secretion of functional full-length SARS-CoV-2 spike protein in Chlamydomonas reinhardtii

  1. Anna Kiefer
  2. Justus Niemeyer
  3. Anna Probst
  4. Gerhard Erkel
  5. Michael Schroda

Reviewed by

Read the full article

Listed in

Log in to save this article

Abstract

The spike protein is the major protein on the surface of coronaviruses. It is therefore the prominent target of neutralizing antibodies and consequently the antigen of all currently admitted vaccines against SARS-CoV-2. Since it is a 1273-amino acids glycoprotein with 22 N-linked glycans, the production of functional, full-length spike protein was limited to mammalian and insect cells, requiring complex culture media. Here we report the production of full-length SARS-CoV-2 spike protein – lacking the C-terminal membrane anchor – as a secreted protein in the prefusion-stabilized conformation in the unicellular green alga Chlamydomonas reinhardtii . We show that the spike protein is efficiently cleaved at the furin cleavage site during synthesis in the alga and that cleavage is abolished upon mutation of the multi-basic cleavage site. We could enrich the spike protein from culture medium by ammonium sulfate precipitation and demonstrate its functionality based on its interaction with recombinant ACE2 and ACE2 expressed on human 293T cells. Chlamydomonas reinhardtii is a GRAS organism that can be cultivated at low cost in simple media at a large scale, making it an attractive production platform for recombinant spike protein and other biopharmaceuticals in low-income countries.

Article activity feed

  1. ScreenIT

    SciScore for 10.1101/2021.12.13.472433: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    Ethicsnot detected.
    Sex as a biological variablenot detected.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Antibodies
    SentencesResources
    Primary antibodies used for immunodetection were mouse anti-HA (H9658, Sigma-Aldrich, 1:10,000)
    anti-HA
    suggested: (Sigma-Aldrich Cat# H9658, RRID:AB_260092)
    The secondary antibody was m-IgGκ BP-HRP (sc-516102, Santa Cruz Biotechnology, 1:10,000)
    sc-516102
    suggested: (Santa Cruz Biotechnology Cat# sc-516102, RRID:AB_2687626)
    , hACE2 was detected with anti-ACE2 antibody (sc-390851, Santa Cruz Biotechnology, 1:2,000)
    anti-ACE2
    suggested: (Santa Cruz Biotechnology Cat# sc-390851, RRID:AB_2861379)
    ), RBD was detected using anti-RBD antibody (MAB105401, R&D Systems, 1:2,000). m-IgGκ BP-HRP was used as secondary antibody for detection (sc-516102, Santa Cruz Biotechnology, 1:10,000).
    anti-RBD
    suggested: None
    Experimental Models: Cell Lines
    SentencesResources
    To validate the functionality of SARS-CoV2 S-protein, HE293T cells that stably overexpress hACE2 and hTMPRSS2 (293T+AT; CL0015 VectorBuilder) and non-transfected HEK293T (293T; ATCC, CRL-3216™) cells were used.
    HE293T
    suggested: None
    HEK293T
    suggested: None
    SARS-CoV 2 spike protein binding assay to cell-based hACE2: 293T+AT and 293T cells were seeded into 6-well plates and grown until they reached 70% confluence.
    293T
    suggested: None
    Experimental Models: Organisms/Strains
    SentencesResources
    (sp carbonic anhydrase (cCA)); B2-pMBS489 (spARS); B2-pMBS490 (spGLE); B3-pMBS704 (CoV2-up); B2-B3-pMBS706 (sec-CoV2-up); B4-pMBS705 (CoV2-down); B4-pMBS708 (CoV2-GSAS/PP-down); B5-pMBS723 (1xHA-8xHis); B5-pMBS514 (SP20-3xHA); B5-pMBS659 (SP20-1xHA-8His); B6-C1-pCM0-119 (RPL23 3’-UTR).
    B6-C1-pCM0-119
    suggested: None
    Recombinant DNA
    SentencesResources
    For this, 45 μg of plasmid DNA (pcDNA3-SARS-CoV-2-S-RBD-sfGFP 61, http://n2t.net/addgene:141184, kindly provided by Erik Procko) were incubated with 2 mL of DMEM.
    pcDNA3-SARS-CoV-2-S-RBD-sfGFP
    suggested: RRID:Addgene_141184)
    To remove the sequence coding for the N-terminal endogenous secretion signal, pMBS704 was used as template for PCR using primers 5’-AAAGAAGACAAAATGAACCTGACCACCCGCACCCAGC-3’ and 5’-AAAGAAGACTTCATTTGAGACCTTTATATCTAGATG-3’.
    pMBS704
    suggested: None
    The resulting 5170-bp PCR product was digested with BbsI and assembled by ligation, giving rise to level 0 part pMBS706 (CoV2-up).
    pMBS706
    suggested: None
    pMBS705 was used as template for site directed mutagenesis PCR to replace codons for the furin recognition site (S1/S2) “RRAR” with codons for “GSAS”, as described previously 7, 44 and to replace the codons for “KV” with two proline codons, as described previously 45, 46.
    pMBS705
    suggested: None
    The three PCR products were combined with pAGM9121 38, digested with BbsI and directionally assembled by ligation into the level 0 part pMBS708 (CoV2-GSAS/PP-down).
    pAGM9121
    suggested: RRID:Addgene_51833)
    pMBS708
    suggested: None
    The product was combined with destination vector pAGM1276 38, digested with BbsI and ligated to yield pMBS489 (spARS2).
    pMBS489
    suggested: None
    The sequence encoding the secretion signal of the gamete lytic enzyme (GLE) was similarly produced via the annealing of oligonucleotides 5’-GAAGACAACCATGAGCCTGGCCACCCGCCGCTTCGGCGCCGCCGCCGCCCTG CTGGTGGCCGCCTGCGTGCTGTGCACCGCCCCCGCCTGGGCAATGAAGTCTTC-3’ and 5’-GAAGACTTCATTGCCCAGGCGGGGGCGGTGCACAGCACGCAGGCGGCCACCA GCAGGGCGGCGGCGGCGCCGAAGCGGCGGGTGGCCAGGCTCATGGTTGTCTT C-3’ followed by digestion with BbsI and ligation with destination vector pAGM1276 38, giving rise to level 0 part pMBS490 (spGLE).
    pAGM1276
    suggested: RRID:Addgene_47986)
    pMBS490
    suggested: None
    Digestion of the annealing product and the destination vector pAGM1301 with BbsI and ligation yielded pMBS723 (1xHA-8xHis).
    pAGM1301
    suggested: RRID:Addgene_47989)
    pMBS723
    suggested: None
    Synthesis and cloning into the pUC57 vector were done by BioCat (Heidelberg), yielding level 0 part pMBS514 (SP20-3xHA).
    pUC57
    suggested: RRID:Addgene_40306)
    pMBS514
    suggested: None
    The 2810-bp PCR product was phosphorylated with polynucleotide kinase (NEB) and circularized with T4 DNA ligase (NEB) as descripted previously 62, generating pMBS659 (SP20-1xHA-8His).
    pMBS659
    suggested: None
    Level 1 module assembly was performed by combining newly constructed level 0 parts with level 0 parts (pCM) from the Chlamydomonas MoClo toolkit 37 and the respective destination vector pICH47742 38.
    pICH47742
    suggested: RRID:Addgene_48001)
    (sp carbonic anhydrase (cCA)); B2-pMBS489 (spARS); B2-pMBS490 (spGLE); B3-pMBS704 (CoV2-up); B2-B3-pMBS706 (sec-CoV2-up); B4-pMBS705 (CoV2-down); B4-pMBS708 (CoV2-GSAS/PP-down); B5-pMBS723 (1xHA-8xHis); B5-pMBS514 (SP20-3xHA); B5-pMBS659 (SP20-1xHA-8His); B6-C1-pCM0-119 (RPL23 3’-UTR).
    B3-pMBS704
    suggested: None
    The level 1 modules were then combined with pCM1-01 (level 1 module with the aadA gene conferring resistance to spectinomycin flanked by the PSAD promoter and terminator) from the Chlamydomonas MoClo kit 37, with plasmid pICH41744 containing the proper end-linker, and with destination vector pAGM4673 38, digested with BpiI, and ligated to yield the five level 2 devices displayed in Figure 1B.
    pCM1-01
    suggested: None
    pICH41744
    suggested: RRID:Addgene_48017)
    pAGM4673
    suggested: RRID:Addgene_48014)
    The PCR product and pET21b were digested with NheI and XhoI, gel-purified, and ligated to get pET-mCherry-6His (pMS1034).
    pET21b
    suggested: RRID:Addgene_111287)
    pET-mCherry-6His
    suggested: None
    pMS1034
    suggested: None
    The resulting 6140-bp PCR product was digested with BamHI and recircularized, giving rise to pET21b-mCherry-6xHis-1xHA (pMS1090).
    pET21b-mCherry-6xHis-1xHA
    suggested: None
    pMS1090
    suggested: None
    Software and Algorithms
    SentencesResources
    Strains and Culture conditions: Chlamydomonas reinhardtii strain CC-4533 harboring an insertion in the SRTA gene (LMJ.RY0402.148523) 39 was obtained from the Chlamydomonas Resource Center (https://www.chlamycollection.org/).
    https://www.chlamycollection.org/
    suggested: (Chlamydomonas Resource Center, RRID:SCR_014960)
    Synthesis and cloning into the pUC57 vector was done by BioCat (Heidelberg), resulting in level 0 parts pMBS704 (secCoV2-up) and pMBS705 (CoV2-down).
    BioCat
    suggested: (BioCAT, RRID:SCR_001440)
    The pellet was resuspended in 5 mL PBS and dialyzed (ZelluTrans 3.5 MWCO, Carl Roth) overnight against PBS.
    ZelluTrans
    suggested: None

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: We did not find any issues relating to colormaps.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  2. Version published to 10.1101/2021.12.13.472433v1 on bioRxiv