1. SciScore for 10.1101/2021.11.24.469842: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    Ethicsnot detected.
    Sex as a biological variablenot detected.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Antibodies
    SentencesResources
    Bound phages were detected by HRP-conjugated anti-M13 antibody (Sino Biological, China)
    anti-M13
    suggested: None
    Bound VHHs were detected by HRP-conjugated anti-Myc-tag antibody and TMB substrate.
    anti-Myc-tag
    suggested: None
    Experimental Models: Cell Lines
    SentencesResources
    After incubation samples were added to a monolayer of Vero E6 cells and incubated in a 5% CO2 incubator at 37 °C for 96-120 h.
    Vero E6
    suggested: None
    Recombinant DNA
    SentencesResources
    Cloning, expression and purification of recombinant SARS-CoV-2 RBD protein: The RBD nucleotide sequence of SARS-CoV-2 Wuhan-Hu-1 isolate (Genbank accession number MN908947, from 319 to 545 aa) was synthesized (Evrogen, Russia) and cloned into the pCEP4 mammalian expression vector (Thermo Fisher Scientific, USA).
    pCEP4
    suggested: RRID:Addgene_16479)
    VHHs coding sequences were PCR amplified and cloned into a pHEN1 phagmid vector (33)
    pHEN1
    suggested: None
    In the second round PCR nanobodies sequences were assembled together and amplified using pHEN1-F and pHEN1-R primers.
    pHEN1-F
    suggested: None
    pHEN1-R
    suggested: None
    VHH-coding sequences were sequenced with Lac-prom (5’-CTTTATGCTTCCGGCTCGTATG-3’) and pIII-R (5’ CTTTCCAGACGTTAGTAAATG 3’) primers according to the protocol of the BigDyeTerminator 3.1 Cycle Sequencing kit for the Genetic Analyzer 3500 Applied Biosystems (Waltham, MA, USA).
    pIII-R
    suggested: None
    Software and Algorithms
    SentencesResources
    EC50 values were calculated using four-parameter logistic regression using GraphPad Prism 9 (GraphPad Software Inc, USA).
    GraphPad
    suggested: (GraphPad Prism, RRID:SCR_002798)
    Sequences were aligned with MUSCLE (v3.8.31) (35).
    MUSCLE
    suggested: (MUSCLE, RRID:SCR_011812)
    The phylogenetic tree was reconstructed using the maximum likelihood method implemented in the PhyML program (v3.1/3.0 aLRT) (36).
    PhyML
    suggested: (PhyML, RRID:SCR_014629)
    Graphical representation and edition of the phylogenetic tree were performed with MEGA X (34).
    MEGA
    suggested: (Mega BLAST, RRID:SCR_011920)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.


    Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


    Results from JetFighter: We did not find any issues relating to colormaps.


    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.


    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

    Read the original source
    Was this evaluation helpful?