Single-domain antibodies efficiently neutralize SARS-CoV-2 variants of concern, including Omicron variant

Article activity feed

1. 

   Version published to 10.1101/2021.11.24.469842v2 on bioRxiv

   Dec 23, 2021
2. 

   ScreenIT

   Nov 30, 2021

   SciScore for 10.1101/2021.11.24.469842: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Ethics	not detected.
   Sex as a biological variable	not detected.
   Randomization	not detected.
   Blinding	not detected.
   Power Analysis	not detected.
   Cell Line Authentication	not detected.

   Table 2: Resources

   Antibodies
   Sentences	Resources
   Bound phages were detected by HRP-conjugated anti-M13 antibody (Sino Biological, China)	anti-M13 suggested: None
   Bound VHHs were detected by HRP-conjugated anti-Myc-tag antibody and TMB substrate.	anti-Myc-tag suggested: None
   Experimental Models: Cell Lines
   Sentences	Resources
   After incubation samples were added to a monolayer of Vero E6 cells and incubated in a 5% CO2 incubator at 37 °C for 96-120 h.	Vero E6 suggested: None
   Recombinant DNA
   Sentences	Resources
   Cloning, expression and purification of …

   SciScore for 10.1101/2021.11.24.469842: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Ethics	not detected.
   Sex as a biological variable	not detected.
   Randomization	not detected.
   Blinding	not detected.
   Power Analysis	not detected.
   Cell Line Authentication	not detected.

   Table 2: Resources

   Antibodies
   Sentences	Resources
   Bound phages were detected by HRP-conjugated anti-M13 antibody (Sino Biological, China)	anti-M13 suggested: None
   Bound VHHs were detected by HRP-conjugated anti-Myc-tag antibody and TMB substrate.	anti-Myc-tag suggested: None
   Experimental Models: Cell Lines
   Sentences	Resources
   After incubation samples were added to a monolayer of Vero E6 cells and incubated in a 5% CO2 incubator at 37 °C for 96-120 h.	Vero E6 suggested: None
   Recombinant DNA
   Sentences	Resources
   Cloning, expression and purification of recombinant SARS-CoV-2 RBD protein: The RBD nucleotide sequence of SARS-CoV-2 Wuhan-Hu-1 isolate (Genbank accession number MN908947, from 319 to 545 aa) was synthesized (Evrogen, Russia) and cloned into the pCEP4 mammalian expression vector (Thermo Fisher Scientific, USA).	pCEP4 suggested: RRID:Addgene_16479)
   VHHs coding sequences were PCR amplified and cloned into a pHEN1 phagmid vector (33)	pHEN1 suggested: None
   In the second round PCR nanobodies sequences were assembled together and amplified using pHEN1-F and pHEN1-R primers.	pHEN1-F suggested: None pHEN1-R suggested: None
   VHH-coding sequences were sequenced with Lac-prom (5’-CTTTATGCTTCCGGCTCGTATG-3’) and pIII-R (5’ CTTTCCAGACGTTAGTAAATG 3’) primers according to the protocol of the BigDyeTerminator 3.1 Cycle Sequencing kit for the Genetic Analyzer 3500 Applied Biosystems (Waltham, MA, USA).	pIII-R suggested: None
   Software and Algorithms
   Sentences	Resources
   EC50 values were calculated using four-parameter logistic regression using GraphPad Prism 9 (GraphPad Software Inc, USA).	GraphPad suggested: (GraphPad Prism, RRID:SCR_002798)
   Sequences were aligned with MUSCLE (v3.8.31) (35).	MUSCLE suggested: (MUSCLE, RRID:SCR_011812)
   The phylogenetic tree was reconstructed using the maximum likelihood method implemented in the PhyML program (v3.1/3.0 aLRT) (36).	PhyML suggested: (PhyML, RRID:SCR_014629)
   Graphical representation and edition of the phylogenetic tree were performed with MEGA X (34).	MEGA suggested: (Mega BLAST, RRID:SCR_011920)

   ---

   Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

   ---

   Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

   ---

   Results from TrialIdentifier: No clinical trial numbers were referenced.

   ---

   Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

   ---

   Results from JetFighter: We did not find any issues relating to colormaps.

   ---

   Results from rtransparent:

   • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
   • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
   • No protocol registration statement was detected.

   ---

   Results from scite Reference Check: We found no unreliable references.

   ---

   Read the original source
3. 

   Version published to 10.1101/2021.11.24.469842v1 on bioRxiv

   Nov 24, 2021