Single-domain antibodies efficiently neutralize SARS-CoV-2 variants of concern, including Omicron variant
This article has been Reviewed by the following groups
Discuss this preprint
Start a discussion What are Sciety discussions?Listed in
- Evaluated articles (ScreenIT)
Abstract
Virus-neutralizing antibodies are one of the few treatment options for COVID-19. The evolution of SARS-CoV-2 virus has led to the emergence of virus variants with reduced sensitivity to some antibody-based therapies. The development of potent antibodies with a broad spectrum of neutralizing activity is urgently needed. Here we isolated a panel of single-domain antibodies that specifically bind to the receptor-binding domain of SARS-CoV-2 S glycoprotein. Three of the selected antibodies exhibiting most robust neutralization potency were used to generate dimeric molecules. We observed that these modifications resulted in up to a 200-fold increase in neutralizing activity. The most potent heterodimeric molecule efficiently neutralized each of SARS-CoV-2 variant of concern, including Alpha, Beta, Gamma, Delta and Omicron variants. This heterodimeric molecule could be a promising drug candidate for a treatment for COVID-19 caused by virus variants of concern.
Article activity feed
-
SciScore for 10.1101/2021.11.24.469842: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics not detected. Sex as a biological variable not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Bound phages were detected by HRP-conjugated anti-M13 antibody (Sino Biological, China) anti-M13suggested: NoneBound VHHs were detected by HRP-conjugated anti-Myc-tag antibody and TMB substrate. anti-Myc-tagsuggested: NoneExperimental Models: Cell Lines Sentences Resources After incubation samples were added to a monolayer of Vero E6 cells and incubated in a 5% CO2 incubator at 37 °C for 96-120 h. Vero E6suggested: NoneRecombinant DNA Sentences Resources Cloning, expression and purification of … SciScore for 10.1101/2021.11.24.469842: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics not detected. Sex as a biological variable not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Bound phages were detected by HRP-conjugated anti-M13 antibody (Sino Biological, China) anti-M13suggested: NoneBound VHHs were detected by HRP-conjugated anti-Myc-tag antibody and TMB substrate. anti-Myc-tagsuggested: NoneExperimental Models: Cell Lines Sentences Resources After incubation samples were added to a monolayer of Vero E6 cells and incubated in a 5% CO2 incubator at 37 °C for 96-120 h. Vero E6suggested: NoneRecombinant DNA Sentences Resources Cloning, expression and purification of recombinant SARS-CoV-2 RBD protein: The RBD nucleotide sequence of SARS-CoV-2 Wuhan-Hu-1 isolate (Genbank accession number MN908947, from 319 to 545 aa) was synthesized (Evrogen, Russia) and cloned into the pCEP4 mammalian expression vector (Thermo Fisher Scientific, USA). pCEP4suggested: RRID:Addgene_16479)VHHs coding sequences were PCR amplified and cloned into a pHEN1 phagmid vector (33) pHEN1suggested: NoneIn the second round PCR nanobodies sequences were assembled together and amplified using pHEN1-F and pHEN1-R primers. pHEN1-Fsuggested: NonepHEN1-Rsuggested: NoneVHH-coding sequences were sequenced with Lac-prom (5’-CTTTATGCTTCCGGCTCGTATG-3’) and pIII-R (5’ CTTTCCAGACGTTAGTAAATG 3’) primers according to the protocol of the BigDyeTerminator 3.1 Cycle Sequencing kit for the Genetic Analyzer 3500 Applied Biosystems (Waltham, MA, USA). pIII-Rsuggested: NoneSoftware and Algorithms Sentences Resources EC50 values were calculated using four-parameter logistic regression using GraphPad Prism 9 (GraphPad Software Inc, USA). GraphPadsuggested: (GraphPad Prism, RRID:SCR_002798)Sequences were aligned with MUSCLE (v3.8.31) (35). MUSCLEsuggested: (MUSCLE, RRID:SCR_011812)The phylogenetic tree was reconstructed using the maximum likelihood method implemented in the PhyML program (v3.1/3.0 aLRT) (36). PhyMLsuggested: (PhyML, RRID:SCR_014629)Graphical representation and edition of the phylogenetic tree were performed with MEGA X (34). MEGAsuggested: (Mega BLAST, RRID:SCR_011920)Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
-
