1. SciScore for 10.1101/2021.11.23.469714: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    Ethicsnot detected.
    Sex as a biological variablenot detected.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Antibodies
    SentencesResources
    As a control, a same number of cells were stained with BV421 anti-hCD45 antibody (Biolegend, #368522) and the top 3% of the BV421-positive cells were sorted.
    anti-hCD45
    suggested: None
    Then the cells were washed two times and resuspended in FACS buffer containing the secondary antibodies at a 1:1000 dilution: AF647-labeled donkey anti-goat IgG (Invitrogen, #A32849) or AF488-labeled goat anti-rabbit IgG (Invitrogen, #A32731).
    AF647-labeled donkey anti-goat IgG
    suggested: None
    anti-rabbit IgG
    suggested: (Thermo Fisher Scientific Cat# A32731, RRID:AB_2633280)
    HRP-conjugated goat anti-human IgG Fc secondary antibody was used to detect the bound ACE2.
    anti-human IgG
    suggested: None
    ACE2
    suggested: None
    To compare GFP expressions in ACE2- and LRRC15-positive cells, pseudovirus-infected cells were stained for surface ACE2 and LRRC15 as described above with following secondary antibodies: AF405-labeled donkey anti-goat IgG (Invitrogen, #A48259) and PE-labeled donkey anti-rabbit IgG (Jackson ImmunoResearch, #711-116-152)
    AF405-labeled donkey anti-goat IgG
    suggested: None
    PE-labeled donkey anti-rabbit IgG
    suggested: None
    Cells were subsequently incubated with recombinant anti-LRRC15 antibody (Abcam, #ab150376) and SARS-CoV-2 spike antibody [1A9] (GeneTex, #GTX632604) at 1:100, followed by incubation with 1:500-diluted Alexa Fluor 555 conjugated goat anti-rabbit IgG antibody (Abcam, #ab150078) and 1:200-diluted Alexa Fluor 488 conjugated goat anti-mouse IgG antibody (Abcam, #ab150117) for 60 min at room temperature.
    anti-LRRC15
    suggested: None
    anti-mouse IgG
    suggested: (Abcam Cat# ab150117, RRID:AB_2688012)
    Experimental Models: Cell Lines
    SentencesResources
    For A375 cells, 5 µg/mL blasticidin (Gibco, #A1113903) and 1 µg/mL puromycin (Gibco, #A1113803) were added as appropriate.
    A375
    suggested: None
    A375-dCas or HeLa-dCas cells were generated by transducing with pLenti-dCas9-VP64-Blast (Addgene, #61425).
    HeLa-dCas
    suggested: None
    7.8 x 107 A375-dCas cells were transduced with the CRISPRa library at ~0.3 MOI to make 2.4 x 107 transduced cells, which is sufficient for the integration of each sgRNA into ~500 cells.
    A375-dCas
    suggested: None
    Briefly, 8 x 106 HEK293T cells were plated in 10-cm tissue culture dishes and transfected using Lipofectamine2000 (Invitrogen) with plasmids encoding different CoV spike proteins or VSV-G protein.
    HEK293T
    suggested: None
    For 1:1 ratio co-culture, 1 x 104 HeLa-ACE2 cells and 1 x 104 HeLa or HeLa-sgLRRC15 cells were plated per well.
    HeLa
    suggested: None
    HeLa-sgLRRC15
    suggested: None
    Microscopic analysis: 8 x 103 HeLa-ACE2 cells and 3.2 x 104 HeLa or HeLa-sgLRRC15 cells (1:4 ratio) were co-plated per well in 8-well chamber slides (Nunc).
    HeLa-ACE2
    suggested: None
    Recombinant DNA
    SentencesResources
    A375-dCas or HeLa-dCas cells were generated by transducing with pLenti-dCas9-VP64-Blast (Addgene, #61425).
    pLenti-dCas9-VP64-Blast
    suggested: None
    Stable ACE2 expressing HeLa cells (HeLa-ACE2) were generated by transducing HeLa-dCas cells with pLENTI_hACE2_HygR (Addgene, #155296) followed selection with hygromycin.
    pLENTI_hACE2_HygR
    suggested: RRID:Addgene_155296)
    For ectopic expression of LRRC15, a lentiviral vector pCDH-MSCV-T2A-Puro (System Biosciences, #CD522A-1) was modified to enable zeocin selection instead of puromycin.
    pCDH-MSCV-T2A-Puro
    suggested: None
    A codon-optimized LRRC15 ORF was cloned into pCDH-MSCV-T2A-Zeo with a C-terminal 3xFLAG tag and used to transduce HeLa-ACE2 followed by zeocin selection.
    pCDH-MSCV-T2A-Zeo
    suggested: None
    The sgRNAs were cloned into pXPR_502 (Addgene, #96923) with assistance from the Genome Engineering and iPSC Center (GEiC) at Washington University in Saint Louis.
    pXPR_502
    suggested: RRID:Addgene_96923)
    Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene, #172320), SARS-CoV-2 B.1.1.7 (Addgene, #170451), SARS-CoV-2 B.1.351 (Addgene, #170449), SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene, #170447), MERS-CoV (Addgene, #170448) and VSV-G (Addgene, #12259) were used.
    VSV-G
    suggested: RRID:Addgene_138479)
    Software and Algorithms
    SentencesResources
    Generation of genetically modified cell lines: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation.
    GACATGCAGGCACTGCACTG
    suggested: None
    After 30 min incubation at 4°C, the cells were washed two times, fixed with 4% formaldehyde for 15 min and washed and resuspended in FACS buffer before analyzing by flow cytometry using FACSCelesta (BD Biosciences) or Cytek
    Cytek
    suggested: None
    Data was analyzed with Flowjo software.
    Flowjo
    suggested: (FlowJo, RRID:SCR_008520)
    GraphPad Prism 9 software was used to perform nonlinear regression curve-fitting analyses of binding data to estimate dissociation constants (KD).
    GraphPad
    suggested: (GraphPad Prism, RRID:SCR_002798)
    To compare LRRC15 expression in lung cell lines infected with SARS-CoV-2 vs mock controls [61], we accessed the raw count data from GSE147507 and performed differential expression analysis using DESeq2 as above.
    DESeq2
    suggested: (DESeq, RRID:SCR_000154)
    Statistical analysis: Statistical significance was determined using GraphPad Prism 9 software.
    GraphPad Prism
    suggested: (GraphPad Prism, RRID:SCR_002798)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.


    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


    Results from JetFighter: We did not find any issues relating to colormaps.


    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.


    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

    Read the original source
    Was this evaluation helpful?