LRRC15 is an inhibitory receptor blocking SARS-CoV-2 spike-mediated entry in trans

SciScore for 10.1101/2021.11.23.469714: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

Ethics	not detected.
Sex as a biological variable	not detected.
Randomization	not detected.
Blinding	not detected.
Power Analysis	not detected.
Cell Line Authentication	not detected.

Table 2: Resources

Antibodies
Sentences	Resources
As a control, a same number of cells were stained with BV421 anti-hCD45 antibody (Biolegend, #368522) and the top 3% of the BV421-positive cells were sorted.	anti-hCD45 suggested: None
Then the cells were washed two times and resuspended in FACS buffer containing the secondary antibodies at a 1:1000 dilution: AF647-labeled donkey anti-goat IgG (Invitrogen, #A32849) or AF488-labeled goat anti-rabbit IgG (Invitrogen, #A32731).	AF647-labeled donkey anti-goat IgG suggested: None anti-rabbit IgG suggested: (Thermo Fisher Scientific Cat# A32731, RRID:AB_2633280)
HRP-conjugated goat anti-human IgG Fc secondary antibody was used to detect the bound ACE2.	anti-human IgG suggested: None ACE2 suggested: None
To compare GFP expressions in ACE2- and LRRC15-positive cells, pseudovirus-infected cells were stained for surface ACE2 and LRRC15 as described above with following secondary antibodies: AF405-labeled donkey anti-goat IgG (Invitrogen, #A48259) and PE-labeled donkey anti-rabbit IgG (Jackson ImmunoResearch, #711-116-152)	AF405-labeled donkey anti-goat IgG suggested: None PE-labeled donkey anti-rabbit IgG suggested: None
Cells were subsequently incubated with recombinant anti-LRRC15 antibody (Abcam, #ab150376) and SARS-CoV-2 spike antibody [1A9] (GeneTex, #GTX632604) at 1:100, followed by incubation with 1:500-diluted Alexa Fluor 555 conjugated goat anti-rabbit IgG antibody (Abcam, #ab150078) and 1:200-diluted Alexa Fluor 488 conjugated goat anti-mouse IgG antibody (Abcam, #ab150117) for 60 min at room temperature.	anti-LRRC15 suggested: None anti-mouse IgG suggested: (Abcam Cat# ab150117, RRID:AB_2688012)
Experimental Models: Cell Lines
Sentences	Resources
For A375 cells, 5 µg/mL blasticidin (Gibco, #A1113903) and 1 µg/mL puromycin (Gibco, #A1113803) were added as appropriate.	A375 suggested: None
A375-dCas or HeLa-dCas cells were generated by transducing with pLenti-dCas9-VP64-Blast (Addgene, #61425).	HeLa-dCas suggested: None
7.8 x 107 A375-dCas cells were transduced with the CRISPRa library at ~0.3 MOI to make 2.4 x 107 transduced cells, which is sufficient for the integration of each sgRNA into ~500 cells.	A375-dCas suggested: None
Briefly, 8 x 106 HEK293T cells were plated in 10-cm tissue culture dishes and transfected using Lipofectamine2000 (Invitrogen) with plasmids encoding different CoV spike proteins or VSV-G protein.	HEK293T suggested: None
For 1:1 ratio co-culture, 1 x 104 HeLa-ACE2 cells and 1 x 104 HeLa or HeLa-sgLRRC15 cells were plated per well.	HeLa suggested: None HeLa-sgLRRC15 suggested: None
Microscopic analysis: 8 x 103 HeLa-ACE2 cells and 3.2 x 104 HeLa or HeLa-sgLRRC15 cells (1:4 ratio) were co-plated per well in 8-well chamber slides (Nunc).	HeLa-ACE2 suggested: None
Recombinant DNA
Sentences	Resources
A375-dCas or HeLa-dCas cells were generated by transducing with pLenti-dCas9-VP64-Blast (Addgene, #61425).	pLenti-dCas9-VP64-Blast suggested: None
Stable ACE2 expressing HeLa cells (HeLa-ACE2) were generated by transducing HeLa-dCas cells with pLENTI_hACE2_HygR (Addgene, #155296) followed selection with hygromycin.	pLENTI_hACE2_HygR suggested: RRID:Addgene_155296)
For ectopic expression of LRRC15, a lentiviral vector pCDH-MSCV-T2A-Puro (System Biosciences, #CD522A-1) was modified to enable zeocin selection instead of puromycin.	pCDH-MSCV-T2A-Puro suggested: None
A codon-optimized LRRC15 ORF was cloned into pCDH-MSCV-T2A-Zeo with a C-terminal 3xFLAG tag and used to transduce HeLa-ACE2 followed by zeocin selection.	pCDH-MSCV-T2A-Zeo suggested: None
The sgRNAs were cloned into pXPR_502 (Addgene, #96923) with assistance from the Genome Engineering and iPSC Center (GEiC) at Washington University in Saint Louis.	pXPR_502 suggested: RRID:Addgene_96923)
Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene, #172320), SARS-CoV-2 B.1.1.7 (Addgene, #170451), SARS-CoV-2 B.1.351 (Addgene, #170449), SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene, #170447), MERS-CoV (Addgene, #170448) and VSV-G (Addgene, #12259) were used.	VSV-G suggested: RRID:Addgene_138479)
Software and Algorithms
Sentences	Resources
Generation of genetically modified cell lines: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation.	GACATGCAGGCACTGCACTG suggested: None
After 30 min incubation at 4°C, the cells were washed two times, fixed with 4% formaldehyde for 15 min and washed and resuspended in FACS buffer before analyzing by flow cytometry using FACSCelesta (BD Biosciences) or Cytek	Cytek suggested: None
Data was analyzed with Flowjo software.	Flowjo suggested: (FlowJo, RRID:SCR_008520)
GraphPad Prism 9 software was used to perform nonlinear regression curve-fitting analyses of binding data to estimate dissociation constants (KD).	GraphPad suggested: (GraphPad Prism, RRID:SCR_002798)
To compare LRRC15 expression in lung cell lines infected with SARS-CoV-2 vs mock controls [61], we accessed the raw count data from GSE147507 and performed differential expression analysis using DESeq2 as above.	DESeq2 suggested: (DESeq, RRID:SCR_000154)
Statistical analysis: Statistical significance was determined using GraphPad Prism 9 software.	GraphPad Prism suggested: (GraphPad Prism, RRID:SCR_002798)

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

Read the original source