Optical nanoscopy reveals SARS-CoV-2-induced remodeling of human airway cells

  1. Wilco Nijenhuis
  2. Hugo G.J. Damstra
  3. Emma J. van Grinsven
  4. Malina K. Iwanski
  5. Patrique Praest
  6. Zahra E. Soltani
  7. Mariëlle M.P. van Grinsven
  8. Jesse E. Brunsveld
  9. Theun de Kort
  10. Lisa W. Rodenburg
  11. Dorien C.M. de Jong
  12. Henriette H.M. Raeven
  13. Sacha Spelier
  14. Gimano D. Amatngalim
  15. Anna Akhmanova
  16. Monique Nijhuis
  17. Robert Jan Lebbink
  18. Jeffrey M. Beekman
  19. Lukas C. Kapitein

Reviewed by

Read the full article See related articles

Listed in

Log in to save this article

Abstract

A better understanding of host cell remodeling by the coronavirus SARS-CoV-2 is urgently needed to understand viral pathogenesis and guide drug development. Expression profiling and electron microscopy have frequently been used to study virus-host interactions, but these techniques do not readily enable spatial, sub-cellular and molecular analysis of specific cellular compartments. Here, we use diffraction-unlimited fluorescence microscopy to analyze how SARS-CoV-2 infection exploits and repurposes the subcellular architecture of primary human airway cells. Using STED nanoscopy, we detect viral entry factors along the motile cilia of ciliated cells and visualize key aspects of the viral life cycle. Using Tenfold Robust Expansion (TREx) microscopy, we analyze the extensively remodeled three-dimensional ultrastructure of SARS-CoV-2-infected ciliated cells and uncover Golgi fragmentation, emergence of large and atypical multivesicular bodies enclosing viral proteins, ciliary clustering, and remodeling of the apical surface. These results demonstrate a broadly applicable strategy to study how viruses reorganize host cells with spatial and molecular specificity and provide new insights into SARS-CoV-2 infection in primary human cell models.

Article activity feed

  1. ScreenIT

    SciScore for 10.1101/2021.08.05.455126: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    EthicsConsent: All donors provided explicit informed consent and the study was approved by the Medical Research Ethics Committee (Tc-BIO protocols 16-856 and 20/806).
    IRB: All donors provided explicit informed consent and the study was approved by the Medical Research Ethics Committee (Tc-BIO protocols 16-856 and 20/806).
    Sex as a biological variablenot detected.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Antibodies
    SentencesResources
    Then, samples were washed three times in 0.1% Triton X-100 in PBS (v/v) for 20 minutes before the addition of corresponding secondary antibodies Alexa Fluor 488-, Alexa Fluor 594, Atto 647N, or Abberior STAR635p-conjugated anti-rabbit and anti-mouse together with DAPI and Phalloidin-Atto-647N (1:200) for 2 hours at room temperature.
    anti-rabbit
    suggested: None
    anti-mouse
    suggested: None
    Phalloidin-Atto-647N
    suggested: None
    Antibodies: Primary antibodies used in this study were rabbit anti-ACE2 (Sino Biological, #80031-RP02), mouse beta-tubulin IV (BioGenex, #MU178-UC), rabbit anti-Calnexin (Abcam, ab22595), mouse anti-CC10 (Origene, AM26360PU-N), Mouse-anti-CD63 (
    anti-ACE2
    suggested: None
    anti-CC10
    suggested: None
    Mouse-anti-CD63
    suggested: None
    DSHB Hybridoma Product H5C6, deposited to the DSHB by August, J.T. / Hildreth, J.E.K.), Mouse anti-Centriolin antibody (C-9, Santa Cruz Biotechnology, sc-365521)
    anti-Centriolin
    suggested: (Santa Cruz Biotechnology Cat# sc-365521, RRID:AB_10851483)
    C-9
    suggested: (Santa Cruz Biotechnology Cat# sc-365521, RRID:AB_10851483)
    , mouse anti-SARS CoV/SARS-CoV-2 Nucleocapsid (Sino Biological, #40143-MM08), rabbit anti-SARS CoV Nsp3 (Rockland, #100-401-A52), rabbit anti-SARS-CoV-2 Spike S1 (Sino Biological, # 40150-R007) and rabbit anti-TMPRSS2 (Atlas Antibodies, Cat# HPA035787).
    anti-SARS CoV/SARS-CoV-2 Nucleocapsid (Sino Biological, #40143-MM08),
    suggested: None
    anti-SARS
    suggested: None
    anti-SARS-CoV-2
    suggested: None
    anti-TMPRSS2
    suggested: (Sigma-Aldrich Cat# HPA035787, RRID:AB_2674782)
    Secondary antibodies were highly cross-adsorbed Alexa Fluor -488 or -594-conjugated goat antibodies against rabbit IgG or mouse IgG, IgG1 or IgG2A (Thermo Fisher Scientific), goat-anti-mouse and goat anti-rabbit Abberior STAR 635P and goat anti-mouse Atto 647N (Sigma-Aldrich), together with Atto 647N Phalloidin (ATTO-TEC) and DAPI (Sigma-Aldrich).
    -594-conjugated goat antibodies against rabbit IgG
    suggested: None
    mouse IgG
    suggested: None
    IgG1
    suggested: None
    IgG2A
    suggested: None
    and goat anti-rabbit Abberior STAR
    suggested: None
    Experimental Models: Cell Lines
    SentencesResources
    Key resources table: Cells: Vero E6 cells and HEK293T cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen) supplemented with 10% fetal calf serum (FCS, PAA laboratories), 100 Units/ml penicillin, 100 µg/ml streptomycin and 2mM L-glutamine.
    HEK293T
    suggested: None
    The respective virus titer was determined by titration of infectious particles on Vero E6 cells (TCID50) and quantitative real-time reverse transcription-PCR (qRT-PCR) specific for the SARS-CoV-2 E gene [69].
    Vero E6
    suggested: None
    Recombinant DNA
    SentencesResources
    Plasmids and cloning: pMD2.G (Addgene#12259) and psPAX2 (Addgene #12260) were gifts from Didier Trono. pFUGW-mCherry-KASH (Addgene #131505,[49]) and pFUGW-spCas9 (Addgene #131506, [49]), pCAGS-PSD95FinR-GFP-TC and pORANGE-empty-FLAG-Cas9 were gifts from Harold MacGillavry. pORANGE-hsACE-GFP KI, a plasmid for C-terminal endogenous tagging of ACE2 using the ORANGE method of CRISPR/Cas9-based genome editing [49], was generated by ligating a primer dimer encoding the target sequence TCTGAACATCATCAGTGTTT into the BbsI sites of pORANGE-empty-FLAG-Cas9.
    pMD2 . G
    suggested: None
    psPAX2
    suggested: RRID:Addgene_12260)
    pFUGW-mCherry-KASH
    suggested: None
    pCAGS-PSD95FinR-GFP-TC
    suggested: None
    pORANGE-empty-FLAG-Cas9
    suggested: None
    pFUGW-hsACE2-GFP-KI_mCherry-KASH, a lentiviral vector for C-terminal endogenous tagging of ACE2 was generated by subcloning the target sequence, gRNA scaffold and EGFP donor sequence, surrounded by target sequences, from pORANGE-hsACE-GFP KI into the PacI site of pFUGW-mCherry-KASH, by Gibson assembly cloning.
    pFUGW-hsACE2-GFP-KI_mCherry-KASH
    suggested: None
    Lentiviral infection and gene editing: Lentivirus packaging was performed by using MaxPEI-based co-transfection of HEK293T cells with psPAX2, pMD2.
    pMD2
    suggested: None
    To generate ACE2-GFP knock-ins in differentiated HNEC, cells were transduced with 20 µl of each concentrated lentivirus, the first produced from pFUGW-spCas9, carrying spCas9 and the second produced from pFUGW-hsACE2-GFP-KI_mCherry-KASH, carrying the sgRNA targeting ACE2 exon 18, the EGFP donor module and the marker mCherry-KASH, labeling infected cells.
    pFUGW-spCas9
    suggested: None
    Software and Algorithms
    SentencesResources
    Secondary antibodies were highly cross-adsorbed Alexa Fluor -488 or -594-conjugated goat antibodies against rabbit IgG or mouse IgG, IgG1 or IgG2A (Thermo Fisher Scientific), goat-anti-mouse and goat anti-rabbit Abberior STAR 635P and goat anti-mouse Atto 647N (Sigma-Aldrich), together with Atto 647N Phalloidin (ATTO-TEC) and DAPI (Sigma-Aldrich).
    STAR
    suggested: (STAR, RRID:SCR_004463)
    The z-stacks were subjected to mild deconvolution using Huygens Professional software version 17.04 (Scientific Volume Imaging, The Netherlands) with the classic maximum likelihood estimation (CMLE) algorithm and the signal-to-noise ratio (SNR) parameter equal to 7 over 10 iterations.
    Huygens Professional
    suggested: None
    For segmentation in Figure 7G, the raw dataset was imported in ImageJ and was segmented for microvilli and cilia using the trainable Weka segmentation plugin [71] (https://zenodo.org/record/59290) in ImageJ.
    ImageJ
    suggested: (ImageJ, RRID:SCR_003070)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 44. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  2. Version published to 10.1101/2021.08.05.455126v1 on bioRxiv