Clinico-histopathologic and single-nuclei RNA-sequencing insights into cardiac injury and microthrombi in critical COVID-19
This article has been Reviewed by the following groups
Discuss this preprint
Start a discussion What are Sciety discussions?Listed in
- Evaluated articles (ScreenIT)
Abstract
Article activity feed
-
-
SciScore for 10.1101/2021.07.27.453843: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics Consent: Next-of-kin provided informed consent for autopsy.
IRB: Patient and autopsy data were manually abstracted from the electronic medical record, as approved by the CUIMC Institutional Review Board (IRB-AAS9835).Sex as a biological variable not detected. Randomization Briefly, CellphoneDB identifies and compares ligand-receptor interaction pairs between cell types and compares the observed interactions to the expected interactions of a null distribution generated from randomly permuted cell labels. Blinding Analysis of all digital slides was performed independently, in parallel, by at least two blinded investigators, using ImageScope ( Power Analysis not detected. Table 2: Resources
Antibodies Sent… SciScore for 10.1101/2021.07.27.453843: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics Consent: Next-of-kin provided informed consent for autopsy.
IRB: Patient and autopsy data were manually abstracted from the electronic medical record, as approved by the CUIMC Institutional Review Board (IRB-AAS9835).Sex as a biological variable not detected. Randomization Briefly, CellphoneDB identifies and compares ligand-receptor interaction pairs between cell types and compares the observed interactions to the expected interactions of a null distribution generated from randomly permuted cell labels. Blinding Analysis of all digital slides was performed independently, in parallel, by at least two blinded investigators, using ImageScope ( Power Analysis not detected. Table 2: Resources
Antibodies Sentences Resources Microscopic imaging and quantitative analysis of histopathologic findings: Four micron thick sections of left and right ventricular FFPE tissue blocks per decedent were cut and labeled using an automated staining platform (Leica Bond 3, Leica Biosystems, Buffalo Grove, IL) with the following monoclonal antibodies against: C4d (Leica Biosystems C4dsuggested: None, BOND Ready-to-Use Primary Antibody, clone SP91) in order to detect cell damage or, in the case of cardiomyocytes, necrosis; CD61 (Cell Marque, prediluted primary antibody, clone EP65,) to identify platelet-rich microthrombi; and CD31 (Leica Biosystems CD61suggested: NoneCD31suggested: NoneSoftware and Algorithms Sentences Resources Analysis of all digital slides was performed independently, in parallel, by at least two blinded investigators, using ImageScope ( ImageScopesuggested: (ImageScope, RRID:SCR_014311)60 To remove homopolymers (A30, T30, G30, and C30) and the template switch oligo sequence (CCCATGTACTCTGCGTTGATACCACTGCTT and its complement AAGCAGTGGTATCAACGCAGA GTACATGGG), reads were trimmed using Cutadapt (v2.8)61 with default parameters. Cutadaptsuggested: (cutadapt, RRID:SCR_011841)The remaining samples were filtered using CellBender v2.0 62 with default settings to remove the ambient RNA byproducts of nuclear isolation. CellBendersuggested: NonePathways were considered enriched within a cell type if identified as such by both Reactome and GSEA Msigdb (BH FDR adjusted P- value of < 0.05). Reactomesuggested: (Reactome, RRID:SCR_003485)Default parameters were used for the analysis (10% threshold for cells expressing ligands and receptors, p-value = 0.05, 1000 iterations for generation of null distribution, curated interactions list compiled by CellphoneDB from UniProt, Ensembl, PDB, IMEx consortium, and IUPHAR). CellphoneDBsuggested: (CellPhoneDB, RRID:SCR_017054)Analyses were performed using SAS (v9.4, SAS Institute) and R(v3.5.1). SAS Institutesuggested: (Statistical Analysis System, RRID:SCR_008567)Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations: Patients were hospitalized prior to FDA-approved therapies, and our initial local practice, as of April 15, 2020, was to reserve steroids for only the most critically-ill appearing patients. Therefore, the nearly statistically significant association of steroid use with increased odds of cardiac microthrombi may reflect some confounding by an unmeasured greater severity of illness. During the study period, testing for other respiratory viruses (i.e., influenza or adenovirus) was not routine. Reassuringly, a study of suspected acute myocarditis patients earlier in the pandemic offers evidence that viral co-infection occurs <5% of the time.54 Our observed associations between clinical variables and presence of cardiac microthrombi may be affected by unmeasured residual confounding and missingness, though we were able to adjust for several confounders via CBPS and we employed multiple imputation. The magnitude of the effect estimates may not be generalizable given our single-center study design. While affording previously unattainable resolution of cell type-specific transcription, snRNA-seq analyses have technological limitations which are discussed extensively in the results and on-line methods as they arise. Importantly, SARS-CoV-2 resides in the cytosol, which is removed during sample processing for snRNA-seq. As such, we could not and did not observe SARS-CoV-2 transcripts in our analysis and must rely upon indirect evidence of viral infection of individual cel...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
-
