1. SciScore for 10.1101/2021.07.16.452733: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    EthicsField Sample Permit: The animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the BIOQUAL Institutional Animal Care and Use Committee (IACUC).
    IACUC: The animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the BIOQUAL Institutional Animal Care and Use Committee (IACUC).
    Sex as a biological variableOne male and 3 females were assigned to the MV-014-212 and RSV groups.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Antibodies
    SentencesResources
    For MV-014-212 and MVK-014-212, we used Rabbit anti-SARS-CoV-2 spike polyclonal antibody (Sino Biological) and Goat anti-rabbit HRP-conjugated secondary antibody (Jackson ImmunoResearch).
    MVK-014-212
    suggested: None
    anti-SARS-CoV-2
    suggested: None
    anti-rabbit
    suggested: None
    For rA2-mKate2, the reagents used were Goat anti-RSV primary antibody (Millipore) and Donkey anti-goat HRP-conjugated secondary antibody (Jackson ImmunoResearch).
    anti-goat
    suggested: None
    The blots were stripped with Restore Western Blot Stripping Buffer (ThermoFisher, Carlsbad, CA) and reprobed with goat anti-RSV polyclonal antisera (Sigma-Aldrich, St. Louis, MO) and a monoclonal antibody specific for GAPDH (6C5) protein (ThermoFisher, Carlsbad, CA).
    anti-RSV
    suggested: None
    GAPDH
    suggested: None
    The plate was washed 4 times with 250 μL PBST and 100 μL of HRP-conjugated goat anti-monkey IgG antibody (PA1-8463, Thermo Fisher, Waltham, MA) diluted in blocking solution was added to each well following the last wash step.
    anti-monkey IgG
    suggested: (Thermo Fisher Scientific Cat# PA1-8463, RRID:AB_2196308)
    PA1-8463
    suggested: (Thermo Fisher Scientific Cat# PA1-8463, RRID:AB_2196308)
    To generate the IgA standard curve anti-human IgA capture antibodies Mab MT57 (MabTech) were absorbed on plates instead of spike antigen.
    anti-human IgA
    suggested: (MABTECH Cat# 3860-4-1000, RRID:AB_10734770)
    The standard total IgA antibody assayed on each test plate was used to calculate the concentration of IgA antibodies against spike protein in the AGM samples expressed in the arbitrary units ELU/mL.
    IgA
    suggested: None
    Spike-specific IgG1 and IgG2a ELISA: Serum samples from mice were collected on Day -21 and on Day 28 post vaccination to quantify the levels of SARS-CoV-2 spike-specific IgG1 and IgG2a antibodies by ELISA.
    Spike-specific IgG1
    suggested: None
    IgG2a
    suggested: None
    Then, 100 μL of HRP-conjugated goat-anti-mouse IgG1 (Thermo Fisher) or HRP-conjugated goat-anti-mouse IgG2a (Thermo Fisher) secondary antibodies diluted 1:32,000 and 1:1000, respectively, were added to each well and the plate was incubated at room temperature for 1 h.
    IgG1
    suggested: None
    Experimental Models: Cell Lines
    SentencesResources
    Virus rescue and harvest: Vero cells were electroporated with the bacterial artificial chromosome (BAC) encoding MV-014-212 (or the reporter virus) together with helper plasmids based on the pCDNA3.1 vector encoding the RSV proteins N, P, M2-1 and L, and the T7 polymerase under the control of a CMV promoter (Hotard 2021).
    Vero
    suggested: None
    Primers / Probe sequences are shown below: SG-F: CGATCTTGTAGATCTGTTCCTCAAACGAAC SG-R: ATATTGCAGCAGTACGCACACACA FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ TCID50 assay to detect shedding of SARS-CoV-2 in BAL and NS of AGMs after challenge: Vero TMPRSS2 cells (obtained from Adrian Creanga, Vaccine Research Center-NIAID) were plated at 25,000 cells/well in DMEM + 10% FBS + Gentamicin and the cultures were incubated at 37°C, 5.0% CO2.
    Vero TMPRSS2
    suggested: None
    Confluent RCB1 cells grown in a clear-bottom black 96-well plate (Grenier) were infected with the serum-virus mixes and centrifuged (spinoculated) at 1,800 x g for 30 minutes at 20 °C.
    RCB1
    suggested: None
    Starting with a dilution of 1/25, serial 2-fold dilutions of heat-inactivated AGM sera were incubated with the pseudotyped viral particles (3 x 105 RLU/well) at 37°C for one hour after which the mixes were used to infect Vero E6 monolayers in white 96-well plates.
    Vero E6
    suggested: None
    Experimental Models: Organisms/Strains
    SentencesResources
    Male and female K18-hACE2 Tg (strain #034860, B6.Cg-Tg[K18-ACE2]2Prlmn/J) mice were procured from The Jackson Laboratory (Bar Harbor, ME) and were approximately 8-10 weeks old at the time of vaccination.
    B6.Cg-Tg[K18-ACE2]2Prlmn/J
    suggested: RRID:IMSR_JAX:034860)
    Recombinant DNA
    SentencesResources
    The kRSV-DB1-QUAD plasmid and spike insert were digested with the enzymes AatII and SalI (NEB) and ligated with T4 DNA ligase (NEB) overnight at 16 ℃.
    kRSV-DB1-QUAD
    suggested: None
    The construction of the plasmid rA2-mkate (a.k.a. kRSV-A2) was described in Rostad 2016.
    rA2-mkate
    suggested: None
    Virus rescue and harvest: Vero cells were electroporated with the bacterial artificial chromosome (BAC) encoding MV-014-212 (or the reporter virus) together with helper plasmids based on the pCDNA3.1 vector encoding the RSV proteins N, P, M2-1 and L, and the T7 polymerase under the control of a CMV promoter (Hotard 2021).
    pCDNA3.1
    suggested: RRID:Addgene_79663)
    Software and Algorithms
    SentencesResources
    The sequence traces were assembled using Sequencher software and the assembly was manually confirmed.
    Sequencher
    suggested: (Sequencher, RRID:SCR_001528)
    The resulting curves of inhibition vs. dilution of the sera were fitted using non-linear regression, option “[inhibitor] vs normalized response-variable slope” in GraphPad Prism (version 9.0.0).
    GraphPad Prism
    suggested: (GraphPad Prism, RRID:SCR_002798)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


    Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
    The use of a semi permissive animal model for the evaluation of the live attenuated vaccine (LAV) candidate MV-014-212 constitutes a limitation of this study, since LAVs rely on replication to elicit a robust immune response. The semi-permissivity of AGMs to RSV and SARS-CoV-2 would result in lower replication of MV-014-212 and a more modest serum neutralizing antibody response. In a more permissive host like humans, MV-014-212 is expected to replicate to higher titers potentially resulting in higher immunogenicity than that observed in AGMs. Remarkably, immunization of AGM with MV-014-212 resulted in both mucosal and systemic antibody responses. There was approximately 100-fold more spike-specific total serum IgG in MV-014-212 vaccinated AGM compared to AGM that received wt RSV A2 or PBS inoculations. Spike-specific IgA was also detected in nasal swabs of MV-014-212 immunized animals. There was approximately an 8-fold increase in IgA concentration 25 days following vaccination with MV-014-212. In an experimental human challenge study, low RSV F-specific mucosal IgA was a better predictor for susceptibility to RSV challenge in seropositive adults than serum IgG and neutralizing antibody levels (Habibi 2015). Indeed, spike RBD-specific dimeric serum IgA was shown to be more potent at neutralizing SARS-CoV-2 than monomeric IgG (Wang 2021). By inference, secretory IgA which exists at mucosal surfaces as dimeric IgA may act as a potent inhibitor of SARS-CoV-2 at the site of infec...

    Results from TrialIdentifier: We found the following clinical trial numbers in your paper:

    IdentifierStatusTitle
    NCT04798001RecruitingSafety and Immunogenicity of an Intranasal RSV Vaccine Expre…


    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


    Results from JetFighter: We did not find any issues relating to colormaps.


    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • No funding statement was detected.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.


    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

    Read the original source
    Was this evaluation helpful?