Mucosal administration of a live attenuated recombinant COVID-19 vaccine protects nonhuman primates from SARS-CoV-2

Article activity feed

1. Version published to 10.1038/s41541-022-00509-6

   Jul 29, 2022
2. 

   Version published to 10.1101/2021.07.16.452733v2 on bioRxiv

   Aug 6, 2021
3. 

   ScreenIT

   Jul 21, 2021

   SciScore for 10.1101/2021.07.16.452733: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Ethics	Field Sample Permit: The animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the BIOQUAL Institutional Animal Care and Use Committee (IACUC). IACUC: The animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the BIOQUAL Institutional Animal Care and Use Committee (IACUC).
   Sex as a biological variable	One male and 3 females were assigned to the MV-014-212 and RSV groups.
   Randomization	not detected.
   Blinding	not detected.
   Power Analysis	not detected.
   Cell Line Authentication	not detected.

   Table 2: Resources

   Antibodies
   Sentences	Resources
   For MV-014-212 and MVK-014-212, we used …

   SciScore for 10.1101/2021.07.16.452733: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Ethics	Field Sample Permit: The animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the BIOQUAL Institutional Animal Care and Use Committee (IACUC). IACUC: The animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the BIOQUAL Institutional Animal Care and Use Committee (IACUC).
   Sex as a biological variable	One male and 3 females were assigned to the MV-014-212 and RSV groups.
   Randomization	not detected.
   Blinding	not detected.
   Power Analysis	not detected.
   Cell Line Authentication	not detected.

   Table 2: Resources

   Antibodies
   Sentences	Resources
   For MV-014-212 and MVK-014-212, we used Rabbit anti-SARS-CoV-2 spike polyclonal antibody (Sino Biological) and Goat anti-rabbit HRP-conjugated secondary antibody (Jackson ImmunoResearch).	MVK-014-212 suggested: None anti-SARS-CoV-2 suggested: None anti-rabbit suggested: None
   For rA2-mKate2, the reagents used were Goat anti-RSV primary antibody (Millipore) and Donkey anti-goat HRP-conjugated secondary antibody (Jackson ImmunoResearch).	anti-goat suggested: None
   The blots were stripped with Restore Western Blot Stripping Buffer (ThermoFisher, Carlsbad, CA) and reprobed with goat anti-RSV polyclonal antisera (Sigma-Aldrich, St. Louis, MO) and a monoclonal antibody specific for GAPDH (6C5) protein (ThermoFisher, Carlsbad, CA).	anti-RSV suggested: None GAPDH suggested: None
   The plate was washed 4 times with 250 μL PBST and 100 μL of HRP-conjugated goat anti-monkey IgG antibody (PA1-8463, Thermo Fisher, Waltham, MA) diluted in blocking solution was added to each well following the last wash step.	anti-monkey IgG suggested: (Thermo Fisher Scientific Cat# PA1-8463, RRID:AB_2196308) PA1-8463 suggested: (Thermo Fisher Scientific Cat# PA1-8463, RRID:AB_2196308)
   To generate the IgA standard curve anti-human IgA capture antibodies Mab MT57 (MabTech) were absorbed on plates instead of spike antigen.	anti-human IgA suggested: (MABTECH Cat# 3860-4-1000, RRID:AB_10734770)
   The standard total IgA antibody assayed on each test plate was used to calculate the concentration of IgA antibodies against spike protein in the AGM samples expressed in the arbitrary units ELU/mL.	IgA suggested: None
   Spike-specific IgG1 and IgG2a ELISA: Serum samples from mice were collected on Day -21 and on Day 28 post vaccination to quantify the levels of SARS-CoV-2 spike-specific IgG1 and IgG2a antibodies by ELISA.	Spike-specific IgG1 suggested: None IgG2a suggested: None
   Then, 100 μL of HRP-conjugated goat-anti-mouse IgG1 (Thermo Fisher) or HRP-conjugated goat-anti-mouse IgG2a (Thermo Fisher) secondary antibodies diluted 1:32,000 and 1:1000, respectively, were added to each well and the plate was incubated at room temperature for 1 h.	IgG1 suggested: None
   Experimental Models: Cell Lines
   Sentences	Resources
   Virus rescue and harvest: Vero cells were electroporated with the bacterial artificial chromosome (BAC) encoding MV-014-212 (or the reporter virus) together with helper plasmids based on the pCDNA3.1 vector encoding the RSV proteins N, P, M2-1 and L, and the T7 polymerase under the control of a CMV promoter (Hotard 2021).	Vero suggested: None
   Primers / Probe sequences are shown below: SG-F: CGATCTTGTAGATCTGTTCCTCAAACGAAC SG-R: ATATTGCAGCAGTACGCACACACA FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ TCID50 assay to detect shedding of SARS-CoV-2 in BAL and NS of AGMs after challenge: Vero TMPRSS2 cells (obtained from Adrian Creanga, Vaccine Research Center-NIAID) were plated at 25,000 cells/well in DMEM + 10% FBS + Gentamicin and the cultures were incubated at 37°C, 5.0% CO2.	Vero TMPRSS2 suggested: None
   Confluent RCB1 cells grown in a clear-bottom black 96-well plate (Grenier) were infected with the serum-virus mixes and centrifuged (spinoculated) at 1,800 x g for 30 minutes at 20 °C.	RCB1 suggested: None
   Starting with a dilution of 1/25, serial 2-fold dilutions of heat-inactivated AGM sera were incubated with the pseudotyped viral particles (3 x 105 RLU/well) at 37°C for one hour after which the mixes were used to infect Vero E6 monolayers in white 96-well plates.	Vero E6 suggested: None
   Experimental Models: Organisms/Strains
   Sentences	Resources
   Male and female K18-hACE2 Tg (strain #034860, B6.Cg-Tg[K18-ACE2]2Prlmn/J) mice were procured from The Jackson Laboratory (Bar Harbor, ME) and were approximately 8-10 weeks old at the time of vaccination.	B6.Cg-Tg[K18-ACE2]2Prlmn/J suggested: RRID:IMSR_JAX:034860)
   Recombinant DNA
   Sentences	Resources
   The kRSV-DB1-QUAD plasmid and spike insert were digested with the enzymes AatII and SalI (NEB) and ligated with T4 DNA ligase (NEB) overnight at 16 ℃.	kRSV-DB1-QUAD suggested: None
   The construction of the plasmid rA2-mkate (a.k.a. kRSV-A2) was described in Rostad 2016.	rA2-mkate suggested: None
   Virus rescue and harvest: Vero cells were electroporated with the bacterial artificial chromosome (BAC) encoding MV-014-212 (or the reporter virus) together with helper plasmids based on the pCDNA3.1 vector encoding the RSV proteins N, P, M2-1 and L, and the T7 polymerase under the control of a CMV promoter (Hotard 2021).	pCDNA3.1 suggested: RRID:Addgene_79663)
   Software and Algorithms
   Sentences	Resources
   The sequence traces were assembled using Sequencher software and the assembly was manually confirmed.	Sequencher suggested: (Sequencher, RRID:SCR_001528)
   The resulting curves of inhibition vs. dilution of the sera were fitted using non-linear regression, option “[inhibitor] vs normalized response-variable slope” in GraphPad Prism (version 9.0.0).	GraphPad Prism suggested: (GraphPad Prism, RRID:SCR_002798)

   ---

   Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

   ---

   Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

   The use of a semi permissive animal model for the evaluation of the live attenuated vaccine (LAV) candidate MV-014-212 constitutes a limitation of this study, since LAVs rely on replication to elicit a robust immune response. The semi-permissivity of AGMs to RSV and SARS-CoV-2 would result in lower replication of MV-014-212 and a more modest serum neutralizing antibody response. In a more permissive host like humans, MV-014-212 is expected to replicate to higher titers potentially resulting in higher immunogenicity than that observed in AGMs. Remarkably, immunization of AGM with MV-014-212 resulted in both mucosal and systemic antibody responses. There was approximately 100-fold more spike-specific total serum IgG in MV-014-212 vaccinated AGM compared to AGM that received wt RSV A2 or PBS inoculations. Spike-specific IgA was also detected in nasal swabs of MV-014-212 immunized animals. There was approximately an 8-fold increase in IgA concentration 25 days following vaccination with MV-014-212. In an experimental human challenge study, low RSV F-specific mucosal IgA was a better predictor for susceptibility to RSV challenge in seropositive adults than serum IgG and neutralizing antibody levels (Habibi 2015). Indeed, spike RBD-specific dimeric serum IgA was shown to be more potent at neutralizing SARS-CoV-2 than monomeric IgG (Wang 2021). By inference, secretory IgA which exists at mucosal surfaces as dimeric IgA may act as a potent inhibitor of SARS-CoV-2 at the site of infec...

   ---

   Results from TrialIdentifier: We found the following clinical trial numbers in your paper:
   

   Identifier	Status	Title
   NCT04798001	Recruiting	Safety and Immunogenicity of an Intranasal RSV Vaccine Expre…

   ---

   Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

   ---

   Results from JetFighter: We did not find any issues relating to colormaps.

   ---

   Results from rtransparent:

   • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
   • No funding statement was detected.
   • No protocol registration statement was detected.

   ---

   Results from scite Reference Check: We found no unreliable references.

   ---

   Read the original source
4. 

   Version published to 10.1101/2021.07.16.452733v1 on bioRxiv

   Jul 19, 2021