Nafamostat-interferon-alpha combination suppresses SARS-CoV-2 infection by targeting cooperatively host TMPRSS2 in vitro and in vivo

  1. Aleksandr Ianevski
  2. Rouan Yao
  3. Hilde Lysvand
  4. Gunnveig Grødeland
  5. Nicolas Legrand
  6. Valentin Oksenych
  7. Eva Zusinaite
  8. Tanel Tenson
  9. Magnar Bjørås
  10. Denis E. Kainov

Reviewed by

Read the full article See related articles

Listed in

Log in to save this article

Abstract

SARS-CoV-2 and its vaccine/immune-escaping variants continue to pose a serious threat to public health due to a paucity of effective, rapidly deployable, and widely available treatments. Here, we address these challenges by combining Pegasys (IFNa) and nafamostat to effectively suppress SARS-CoV-2 infection in cell culture and hamsters. Our results indicate that Serpin E1 is an important mediator of the antiviral activity of IFNa and that both Serpin E1 and camostat can target the same cellular factor TMPRSS2, which plays a critical role in viral replication. The low doses of the drugs in combination may have several clinical advantages, including fewer adverse events and improved patient outcome. Thus, our study may provide a proactive solution for the ongoing pandemic and potential future coronavirus outbreaks, which is still urgently required in many parts of the world.

Article activity feed

  1. Version published to 10.1101/2021.06.16.448653v2 on bioRxiv
  2. ScreenIT

    SciScore for 10.1101/2021.06.16.448653: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    EthicsIACUC: All animal procedures (including surgery, anesthesia, and euthanasia as applicable) were approved by the Institutional Animal Care and Use Committee of CEA and French authorities (CETEA DSV – n° 44).
    Sex as a biological variableThirty-five 6-week-old healthy female Syrian hamsters were obtained from Janvier Labs.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Experimental Models: Cell Lines
    SentencesResources
    Recombinant mCherry-expressing SARS-CoV-2 (SARS-CoV-2-mCherry), and wild type human SARS-CoV-2 strains were provided by Prof. Andres Merits or the European Virus Archive global (EVAg) and propagated in Vero E6 or Vero E6/TMPRSS2 cells.
    Vero E6
    suggested: RRID:CVCL_XD71)
    Vero E6/TMPRSS2
    suggested: None
    Drug Combination Testing and Synergy Calculations: Calu-3 cells were treated with different concentrations of two drugs and infected with SARS-CoV-2-mCherry (moi 0.1) or mock.
    Calu-3
    suggested: None
    Experimental Models: Organisms/Strains
    SentencesResources
    RT-PCR was performed using SuperScript™ III One-Step qRT-PCR System kit (commercial kit #1732-020, Life Technologies) with primers ORF1ab_Fw: CCGCAAGGTTCTTCTTCGTAAG, ORF1ab_Rv: TGCTATGTTTAGTGTTCCAGTTTTC, ORF1ab_probe: Hex-AAGGATCAGTGCCAAGCTCGTCGCC-BHQ-1 targeting a region on ORF1ab.
    Hex-AAGGATCAGTGCCAAGCTCG TCGCC-BHQ-1
    suggested: None
    Software and Algorithms
    SentencesResources
    The half-maximal cytotoxic concentration (CC50) for each compound was calculated based on viability/death curves obtained on mock-infected cells after non-linear regression analysis with a variable slope using GraphPad Prism software version 7.0a.
    GraphPad Prism
    suggested: (GraphPad Prism, RRID:SCR_002798)
    The expected responses were calculated based on the ZIP reference model using SynergyFinder version 2 [17, 18].
    SynergyFinder
    suggested: (SynergyFinder, RRID:SCR_019318)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: We found the following clinical trial numbers in your paper:

    IdentifierStatusTitle
    NCT04623021CompletedA Study Evaluating the Efficacy and Safety of CKD-314 (Nafab…
    NCT04473053RecruitingRapid Experimental Medicine for COVID-19
    NCT04390594RecruitingEfficacy and Safety Evaluation of Treatment Regimens in Adul…
    NCT04483960RecruitingAustralasian COVID-19 Trial (ASCOT) ADAptive Platform Trial

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: We did not find any issues relating to colormaps.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  3. Version published to 10.1101/2021.06.16.448653v1 on bioRxiv