Evolution of enhanced innate immune evasion by the SARS-CoV-2 B.1.1.7 UK variant

  1. Lucy G Thorne
  2. Mehdi Bouhaddou
  3. Ann-Kathrin Reuschl
  4. Lorena Zuliani-Alvarez
  5. Ben Polacco
  6. Adrian Pelin
  7. Jyoti Batra
  8. Matthew V.X. Whelan
  9. Manisha Ummadi
  10. Ajda Rojc
  11. Jane Turner
  12. Kirsten Obernier
  13. Hannes Braberg
  14. Margaret Soucheray
  15. Alicia Richards
  16. Kuei-Ho Chen
  17. Bhavya Harjai
  18. Danish Memon
  19. Myra Hosmillo
  20. Joseph Hiatt
  21. Aminu Jahun
  22. Ian G. Goodfellow
  23. Jacqueline M. Fabius
  24. Kevan Shokat
  25. Natalia Jura
  26. Klim Verba
  27. Mahdad Noursadeghi
  28. Pedro Beltrao
  29. Danielle L. Swaney
  30. Adolfo Garcia-Sastre
  31. Clare Jolly
  32. Greg J. Towers
  33. Nevan J. Krogan

Reviewed by

Read the full article See related articles

Listed in

Log in to save this article

Abstract

Emergence of SARS-CoV-2 variants, including the globally successful B.1.1.7 lineage, suggests viral adaptations to host selective pressures resulting in more efficient transmission. Although much effort has focused on Spike adaptation for viral entry and adaptive immune escape, B.1.1.7 mutations outside Spike likely contribute to enhance transmission. Here we used unbiased abundance proteomics, phosphoproteomics, mRNA sequencing and viral replication assays to show that B.1.1.7 isolates more effectively suppress host innate immune responses in airway epithelial cells. We found that B.1.1.7 isolates have dramatically increased subgenomic RNA and protein levels of Orf9b and Orf6, both known innate immune antagonists. Expression of Orf9b alone suppressed the innate immune response through interaction with TOM70, a mitochondrial protein required for RNA sensing adaptor MAVS activation, and Orf9b binding and activity was regulated via phosphorylation. We conclude that B.1.1.7 has evolved beyond the Spike coding region to more effectively antagonise host innate immune responses through upregulation of specific subgenomic RNA synthesis and increased protein expression of key innate immune antagonists. We propose that more effective innate immune antagonism increases the likelihood of successful B.1.1.7 transmission, and may increase in vivo replication and duration of infection.

Article activity feed

  1. ScreenIT

    SciScore for 10.1101/2021.06.06.446826: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    NIH rigor criteria are not applicable to paper type.

    Table 2: Resources

    Antibodies
    SentencesResources
    Membranes were probed with rabbit-anti-SARS spike (Invitrogen, PA1-411-1165, 0.5ug/ml), rabbit-anti-Orf6 (Abnova, PAB31757, 4ug/ml), Cr3009 SARS-CoV-2 cross-reactive human-anti-N antibody (1ug/ml) (a kind gift from Dr. Laura McCoy, UCL), mouse-anti-alpha-tubulin (
    rabbit-anti-Orf6
    suggested: None
    PAB31757
    suggested: None
    mouse-anti-alpha-tubulin
    suggested: None
    SIGMA, clone DM1A) followed by IRDye 800CW or 680RD secondary antibodies (Abcam, goat anti-rabbit, goat anti-mouse or goat anti-human).
    anti-rabbit
    suggested: None
    anti-human) .
    suggested: None
    Cells were then incubated with 1μg/ml CR3009 SARS-CoV-2 cross-reactive antibody (a kind gift from Dr. Laura McCoy, UCL) in permeabilization buffer for 30 min at room temperature, washed once and incubated with secondary Alexa Fluor 488-Donkey-anti-Human IgG (Jackson Labs).
    488-Donkey-anti-Human IgG
    suggested: None
    A blocking step was carried out for 1h at room temperature with 10% goat serum/1%BSA in PBS. Nucleocapsid (N) protein detection was performed by primary incubation with human anti-N antibody (Cr3009, 1ug/ml) for 18h, and washed thoroughly in PBS.
    anti-N
    suggested: None
    Cr3009
    suggested: None
    Primary antibodies were detected by labelling with secondary anti-human AlexaFluor-568 and anti-mouse AlexaFluor 488 conjugates (Jackson Immuno Research) for 1h.
    anti-mouse
    suggested: None
    Antibodies: Rabbit anti–Strep-tag II (Abcam #ab232586); Rabbit anti-beta-actin (Cell Signaling Technology #4967); Monoclonal mouse anti-FLAG M2 antibody (Sigma Aldrich, F1804)
    anti–Strep-tag II
    suggested: None
    anti-beta-actin
    suggested: None
    anti-FLAG
    suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)
    F1804
    suggested: None
    Experimental Models: Cell Lines
    SentencesResources
    Hela-ACE2 cells were a kind gift from Dr. James E Voss (TSRI, USA)51
    Hela-ACE2
    suggested: None
    Calu-3 cells were grown to 60-80% confluence prior to infection as described previously23. Viruses: SARS-CoV-2 isolate VIC was provided by NISBC, and IC19, B.1.1.7, B.1.1.7 (B) and B.1.1.7 (C) are reported in 11, full isolate names and GISAID references are listed below.
    Calu-3
    suggested: None
    Viruses were propagated by infecting Caco-2 cells at MOI 0.01 TCID50/cell, in culture medium at 37°C.
    Caco-2
    suggested: None
    Innate immune sensing assay: HEK293T cells were seeded in 48-well plates (5×104 cells/well) the day before transfection.
    HEK293T
    suggested: None
    Recombinant DNA
    SentencesResources
    For viral protein expression, cells were transfected with 100ng of empty vector or vector encoding either ORF9b, ORF9bS50/53E, VIC N or B.1.1.7 N (pLVX-EF1alpha-IRES-Puro backbone), alongside 10ng of ISG56-firefly luciferase reporter plasmid (kindly provided by Andrew Bowie, Trinity College Dublin), and 2.5ng of a Renilla luciferase under control of thymidine kinase promoter (Promega), as a control for transfection.
    pLVX-EF1alpha-IRES-Puro
    suggested: None
    Software and Algorithms
    SentencesResources
    Amplicon libraries were sequenced using MinION flow cells v9.4.1 (Oxford Nanopore Technologies, Oxford, UK).
    MinION
    suggested: (MinION, RRID:SCR_017985)
    All samples were acquired on a BD Fortessa X20 using BD FACSDiva software.
    BD FACSDiva
    suggested: (BD FACSDiva Software, RRID:SCR_001456)
    Data was analysed using FlowJo v10 (Tree Star).
    FlowJo
    suggested: (FlowJo, RRID:SCR_008520)
    Image analysis of immunofluorescence experiments: IRF3 raw image channels were pre-processed using a batch rolling ball background correction in FIJI imagej software package56 prior to 514 quantification.
    imagej
    suggested: (ImageJ, RRID:SCR_003070)
    Plotted are 1000 randomly sampled cells selected for each condition using the ‘Pandas’ data processing package in Python 3 with a filter of 0.1>=<5. Coimmunoprecipitation of Tom70 with Orf9b: HEK293T were transfected with the indicated mammalian expression plasmids using Lipofectamine 2000 (Invitrogen).
    Python
    suggested: (IPython, RRID:SCR_001658)
    For all analyses, samples were injected on a C18 reverse phase column (25 cm × 75 μm packed with ReprosilPur 1.9 μm particles).
    ReprosilPur
    suggested: None
    Total RNA samples were run on the Agilent Bioanalyzer, using the Agilent RNA 6000 Nano Kit.
    Agilent Bioanalyzer
    suggested: None
    Reads containing possible junctions were extracted by filtering for exact matches to the 3’ end of the leader sequence “CTTTCGATCTCTTGTAGATCTGTTCTC” using the bbduk program in the BBTools package (BBTools -Bushnell B. - sourceforge.net/projects/bbmap/).
    BBTools
    suggested: (Bestus Bioinformaticus Tools, RRID:SCR_016968)
    The filtered and trimmed reads were matched against SARS2 genomic sequence with the bbmap program from BBtools with settings (maxindel=100, strictmaxindel=t, local=t).
    bbmap
    suggested: (BBmap, RRID:SCR_016965)
    Host RNA analysis: All reads were mapped to the human host genome (ensembl 101) using HISAT2 aligner58
    HISAT2
    suggested: (HISAT2, RRID:SCR_015530)
    Differential gene expression were done on read counts extracted for each protein coding gene using featureCount and significance was determined by the DESeq2 R package60.
    DESeq2
    suggested: (DESeq, RRID:SCR_000154)
    The resource comprises of a comprehensive collection of phosphosite annotations of direct substrates of kinases obtained from six databases, PhosphoSitePlus, SIGNOR, HPRD, NCI-PID
    HPRD
    suggested: None

    Results from OddPub: Thank you for sharing your data.

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: We did not find any issues relating to colormaps.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  2. Version published to 10.1101/2021.06.06.446826v1 on bioRxiv