Design, immunogenicity and efficacy of a Pan-SARS-CoV-2 synthetic DNA vaccine

Article activity feed

1. 

   Version published to 10.1101/2021.05.11.443592v2 on bioRxiv

   Aug 4, 2021
2. 

   ScreenIT

   May 14, 2021

   SciScore for 10.1101/2021.05.11.443592: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Ethics	IACUC: All animal treatments and procedures were performed at Acculab, and animal testing and research complied with all relevant ethical regulations and studies received ethical approval by the Acculab Institutional Animal Care and Use Committees (IACUC)
   Sex as a biological variable	Seven donors were male, and thirteen were female.
   Randomization	not detected.
   Blinding	not detected.
   Power Analysis	not detected.
   Cell Line Authentication	not detected.

   Table 2: Resources

   Antibodies
   Sentences	Resources
   Proteins were separated on a 4–12% BIS-TRIS gel (ThermoFisher Scientific), then following transfer, blots were incubated with an anti-SARS-CoV spike protein polyclonal antibodies (S1, Sino Biological #40591-T62; …

   SciScore for 10.1101/2021.05.11.443592: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Ethics	IACUC: All animal treatments and procedures were performed at Acculab, and animal testing and research complied with all relevant ethical regulations and studies received ethical approval by the Acculab Institutional Animal Care and Use Committees (IACUC)
   Sex as a biological variable	Seven donors were male, and thirteen were female.
   Randomization	not detected.
   Blinding	not detected.
   Power Analysis	not detected.
   Cell Line Authentication	not detected.

   Table 2: Resources

   Antibodies
   Sentences	Resources
   Proteins were separated on a 4–12% BIS-TRIS gel (ThermoFisher Scientific), then following transfer, blots were incubated with an anti-SARS-CoV spike protein polyclonal antibodies (S1, Sino Biological #40591-T62; S2, Invitrogen #PA1-41165; RBD, Sino Biological #40592-MP01) then visualized with horseradish peroxidase (HRP)-conjugated anti-mouse or anti-rabbit IgG (Bethyl) (GE Amersham).	anti-SARS-CoV spike protein suggested: None S2 suggested: None anti-mouse suggested: None anti-rabbit IgG suggested: None
   Cells were washed off, and the plates were developed via a biotinylated anti-IFN-γ detection antibody followed by a streptavidin-enzyme conjugate resulting in visible spots.	anti-IFN-γ suggested: None
   Whole blood was directly stained using the same viability dye and fluorescently-conjugated antibodies described above for CD3, CD4, and CD8.	CD3 suggested: None CD4 suggested: None CD8 suggested: None
   The antibody cocktail also included the canonical Tfh markers CXCR5-biotin (BD Biosciences), PD-1 PE-CF594 (BD Biosciences), and ICOS BV650 (BD Biosciences) in the presence of Fc block (BD Biosciences).	CXCR5-biotin suggested: (Leinco Technologies Cat# C1567, RRID:AB_2828639)
   Experimental Models: Cell Lines
   Sentences	Resources
   Cell lines and In-vitro plasmid expression: HEK-293T (ATCC® CRL-3216™) and African Green monkey kidney COS-7 (ATCC® CRL-1651™) cell lines were obtained from ATCC (Old Town Manassas, VA).	HEK-293T suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)
   For in vitro protein expression by Western blot, human embryonic kidney cells, 5.5×105 293T were transfected with 2.5μg pDNA in 6-well plates using Lipofectamine 3000 (Invitrogen #L3000015	293T suggested: None
   β-actin Reverse – CAGGGCAGTAATCTCCTTCTG; β-actin Probe – TACCCTGGCATTGCTGACAGGATG) for COS-7 cell line β-actin sequences.	COS-7 suggested: CLS Cat# 605470/p532_COS-7, RRID:CVCL_0224)
   pseudotyped stocks encoding for the WT, B.1.1.7, P.1, or B.1.351 Spike protein (Table 2) were produced using HEK 293T cells transfected with Lipofectamine 3000 (ThermoFisher) using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.	HEK 293T suggested: None
   Pseudotyped neutralization: CHO cells stably expressing ACE2 (ACE2-CHOs) to allow permissiveness to SARS-CoV-2, were seeded at 10,000 cells/well.	CHO suggested: None
   Experimental Models: Organisms/Strains
   Sentences	Resources
   In-vivo immunogenicity: BALB/c mice (6 weeks old, Jackson Laboratory, Bar Harbor, ME) and Syrian Golden Hamsters (8 weeks old, Envigo, Indianapolis, IN) were housed at Acculab (San Diego, CA).	BALB/c suggested: RRID:IMSR_ORNL:BALB/cRl)
   The antibody cocktail also included the canonical Tfh markers CXCR5-biotin (BD Biosciences), PD-1 PE-CF594 (BD Biosciences), and ICOS BV650 (BD Biosciences) in the presence of Fc block (BD Biosciences).	PD-1 PE-CF594 suggested: None
   Recombinant DNA
   Sentences	Resources
   Strain-matched spike sequences (pWT, pB.1.351) were similarly optimized and cloned into identical restriction site locations into the pGX0001 backbone.	pB.1.351 suggested: None pGX0001 suggested: None
   Cell lines and In-vitro plasmid expression: HEK-293T (ATCC® CRL-3216™) and African Green monkey kidney COS-7 (ATCC® CRL-1651™) cell lines were obtained from ATCC (Old Town Manassas, VA).	In-vitro suggested: None
   PCR was performed using a single set of primers and probes recognizing the RNA products of all three plasmids (pS-spike forward ATGATCGCCCAGTACACATC, pS-spike reverse CACGCCGATGCCATTAAATC, pS-spike probe AT CACCAGTGGCTGGACATTTGGA).	pS-spike suggested: None
   pseudotyped stocks encoding for the WT, B.1.1.7, P.1, or B.1.351 Spike protein (Table 2) were produced using HEK 293T cells transfected with Lipofectamine 3000 (ThermoFisher) using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.	pNL4-3 suggested: None
   Software and Algorithms
   Sentences	Resources
   Sequence analysis was performed using custom Python scripts (Python Software Foundation,	Python suggested: (IPython, RRID:SCR_001658)
   https://www.python.org/) and assembly was performed using Geneious Prime® 2020.2.3 (Build 2020-08-25, Biomatters Ltd., Auckland	https://www.python.org/ suggested: (CVXOPT - Python Software for Convex Optimization, RRID:SCR_002918) Geneious suggested: (Geneious, RRID:SCR_010519)
   Neutralization titers (ID50) were calculated using GraphPad Prism 8 and defined as the reciprocal serum dilution at which RLU were reduced by 50% compared to RLU in virus control wells after subtraction of background RLU in cell control wells.	GraphPad Prism suggested: (GraphPad Prism, RRID:SCR_002798)
   Data were analyzed using FlowJo software.	FlowJo suggested: (FlowJo, RRID:SCR_008520)
   (GraphPad Software, San Diego, USA) was used for graphical and statistical analysis of data sets.	GraphPad suggested: (GraphPad Prism, RRID:SCR_002798)

   ---

   Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

   ---

   Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

   Some limitations of the current study include the lack of efficacy testing in a challenge model. Challenge studies to assess efficacy in appropriate animal models are currently in planning for INO-4802. Importantly, it is encouraging that pseudotyped virus nAb titers measured here exceed levels reported to correlate with protection in relevant animal models (Fig. 2b & [45]). The pseudotyped virus testing panel used in this study consisted of currently known VOCs. Over time, additional novel VOCs are expected to emerge or to rise in importance through changing epidemiology. As they emerge, these new variants will be interrogated similarly in our assay platform as a continuous screening read-out. We have reported on the design and testing of a pan-SARS-CoV-2 vaccine, INO-4802. High levels of cross-reactive neutralizing activity against multiple VOCs was demonstrated by pseudotyped virus neutralization, superior to that shown by strain-matched vaccines. Additionally, INO-4802 has shown utility in both prime and heterologous boost immunization scenarios. Vaccination with INO-4802 led to cross-reactive T cell immune responses as well as circulating populations of Tfh cells correlative of both memory and neutralizing antibody responses. In summary, INO-4802 represents a potentially useful pan-SARS-CoV-2 vaccine approach against multiple variants of concern and the data presented in this report supports its further development.

   ---

   Results from TrialIdentifier: No clinical trial numbers were referenced.

   ---

   Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

   ---

   Results from JetFighter: We did not find any issues relating to colormaps.

   ---

   Results from rtransparent:

   • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
   • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
   • No protocol registration statement was detected.

   ---

   Results from scite Reference Check: We found no unreliable references.

   ---

   Read the original source
3. 

   Version published to 10.1101/2021.05.11.443592v1 on bioRxiv

   May 11, 2021