ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signaling

  1. Beibei Wu
  2. Arunachalam Ramaiah
  3. Gustavo Garcia
  4. Yousang Gwack
  5. Vaithilingaraja Arumugaswami
  6. Sonal Srikanth

Reviewed by

Read the full article See related articles

Listed in

Log in to save this article

Abstract

ORAI1 and STIM1 are the critical mediators of store-operated Ca 2+ entry by acting as the pore subunit and an endoplasmic reticulum-resident signaling molecule, respectively. In addition to Ca 2+ signaling, STIM1 is also involved in regulation of a cytosolic nucleic acid sensing pathway. Using ORAI1 and STIM1 knockout cells, we examined their contribution to the host response to SARS-CoV-2 infection. STIM1 knockout cells showed strong resistance to SARS-CoV-2 infection due to enhanced type I interferon response. On the contrary, ORAI1 knockout cells showed high susceptibility to SARS-CoV-2 infection as judged by increased expression of viral proteins and a high viral load. Mechanistically, ORAI1 knockout cells showed reduced homeostatic cytoplasmic Ca 2+ concentration and severe impairment in tonic interferon signaling. Transcriptome analysis showed downregulation of multiple cellular defense mechanisms, including antiviral signaling pathways in ORAI1 knockout cells, which are likely due to reduced expression of the Ca 2+ -dependent transcription factors of the activator protein 1 (AP-1) family and MEF2C . Our results identify a novel role of ORAI1-mediated Ca 2+ signaling in regulating the baseline type I interferon level, which is a determinant of host resistance to SARS-CoV-2 infection.

Article activity feed

  1. ScreenIT

    SciScore for 10.1101/2021.05.04.442548: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    Ethicsnot detected.
    Sex as a biological variablenot detected.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Antibodies
    SentencesResources
    Chemicals and Antibodies: Fura 2-AM (F1221) was purchased from Thermofisher Scientific.
    F1221
    suggested: None
    SARS-CoV Spike (S) antibodies - polyclonal anti-SARS coronavirus (BEI
    anti-SARS
    suggested: None
    Resources: NR-10361 antiserum, Guinea Pig) was used for immunoblotting and monoclonal anti-SARS-CoV S protein antibody (BEI Resources: NR-616, similar to 240C) was used for immunocytochemistry.
    anti-SARS-CoV S protein
    suggested: (BioLegend Cat# 944301, RRID:AB_2890871)
    Antibodies for detection of human STIM1 (5668S) was purchased from Cell Signaling Technologies, that for detection of interferon alpha and beta receptor 1 (IFNAR-1) was purchased from Leinco Technologies, Inc. (I-400), that for detection of surface ORAI1 (ACC-060) was purchased from Alomone labs and that for detection of β-actin (sc-47778), was obtained from Santa Cruz Biotechnology.
    STIM1
    suggested: (Cell Signaling Technology Cat# 5668, RRID:AB_10828699)
    β-actin
    suggested: (Santa Cruz Biotechnology Cat# sc-47778 HRP, RRID:AB_2714189)
    Endogenous ORAI1 staining and analysis: For total endogenous ORAI1 detection, control, STIM1 KO and ORAI1 KO HEK293 or A549 cells (0.5 × 106) were fixed with 4% PFA at room temperature for 15 mins, followed by permeabilization with PBS + 0.5% Igepal CA-630 and incubated with 1 μg unlabeled anti-ORAI1 antibody (ACC-060, Alomone labs) in PBS + 2% FBS + 0.5% Igepal CA-630.
    ORAI1 KO HEK293
    suggested: None
    anti-ORAI1
    suggested: None
    Experimental Models: Cell Lines
    SentencesResources
    Vero cells were cultured in EMEM growth media (ATCC) supplemented with 10% (v/v)
    Vero
    suggested: None
    SARS-CoV-2 was passaged once in Vero E6 cells and viral stocks were aliquoted and stored at −80°C.
    Vero E6
    suggested: RRID:CVCL_XD71)
    Lentiviral transduction of HEK293 and A549 cells: To generate HEK293-ACE2 cells, HEK293T cells were transfected with plasmid encoding ACE2 and packaging vectors (pMD2.
    HEK293
    suggested: None
    HEK293T
    suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)
    For generation of ORAI1-/- and STIM1-/- cells, HEK293T cells were transfected with plasmids encoding sgRNA and packaging vectors as described above.
    STIM1-/-
    suggested: None
    Single-cell Ca2+ imaging and immunofluorescence analysis: HEK293-ACE and A549 cells were grown overnight on coverslips and loaded with 1 μM Fura 2-AM for 40 min at 25°C for imaging.
    A549
    suggested: None
    SARS-CoV-2 Infection: Control, ORAI1-/-, or STIM1-/- HEK293-ACE2 cells were seeded at 1 x 105 cells per well in 0.4 ml volumes using a 48-well plate, or 5 x 104 cells per well in 0.2 ml volume in a 96-well plate.
    HEK293-ACE2
    suggested: None
    Recombinant DNA
    SentencesResources
    sgRNAs targeting human ORAI1 (Forward primer: CACCGGATCGGCCAGAGTTACTCC; Reverse primer: AAACCGGAGTAACTCTGGCCGATCC) and human STIM1 (Forward primer: CACCGTGAGGATAAGCTCATCAGCG; Reverse Primer: AAACCGCTGATGAGCTTATCCTCAC) genes were subcloned into pLentiguide puro (Addgene).
    pLentiguide puro
    suggested: None
    sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1) subcloned into pLentiCRISPR v2 was purchased from GenScript (catalog # IFNAR1 crRNA 1; gRNA target sequence GGCGTGTTTCCAGACTGTTT).
    pLentiCRISPR
    suggested: RRID:Addgene_102315)
    Lentiviral transduction of HEK293 and A549 cells: To generate HEK293-ACE2 cells, HEK293T cells were transfected with plasmid encoding ACE2 and packaging vectors (pMD2.
    pMD2
    suggested: None
    G and psPAX2, Addgene) using calcium phosphate transfection method.
    psPAX2
    suggested: RRID:Addgene_12260)
    Software and Algorithms
    SentencesResources
    Cells were subsequently treated with FITC-conjugated secondary antibody, washed and data was acquired on a BD Fortessa flow cytometer (BD Biosciences) and analyzed using FlowJo software (Treestar Inc)
    FlowJo
    suggested: (FlowJo, RRID:SCR_008520)
    Cells were stained overnight in the blocking buffer with primary antibodies washed and treated with secondary antibody for 1 h, stained for DAPI in permeabilization solution and visualized using 40X oil immersion lens and imaged using Slidebook 6.0 software (Intelligent Imaging Innovations, Inc.).
    Slidebook
    suggested: (SlideBook , RRID:SCR_014300)
    Demultiplexing was performed with Illumina Bcl2fastq v2.19.1.403 software.
    Bcl2fastq
    suggested: (bcl2fastq , RRID:SCR_015058)
    Illumina reads from all the samples were mapped to human and SARS-CoV-2 reference genomes by STAR v2.27a (Dobin et al., 2013) and read counts per gene were quantified using human Ensembl GRCh38.98 and SARS-CoV-2 GTF file to generate raw reads counts.
    STAR
    suggested: (STAR, RRID:SCR_004463)
    Ensembl
    suggested: (Ensembl, RRID:SCR_002344)
    Differential expression analysis was performed using DESeq2 v1.28.1 in R v4.0.3 (Love et al., 2014).
    DESeq2
    suggested: (DESeq, RRID:SCR_000154)
    Unsupervised principal component analysis was performed using pcaExplorer (Marini and Binder, 2019) in R v4.0.3 (Love et al., 2014)
    Binder
    suggested: (Binder, RRID:SCR_016437)
    Reactome pathway analysis was performed for DEGs using human all genes as reference data set in the Reactome v65 (Jassal et al., 2020) implemented in PANTHER.
    PANTHER
    suggested: (PANTHER, RRID:SCR_004869)
    The ggplot2 v3.3.2 in R and Prism GraphPad v8.4.3 were used to generate figures.
    ggplot2
    suggested: (ggplot2, RRID:SCR_014601)
    Prism
    suggested: (PRISM, RRID:SCR_005375)
    GraphPad
    suggested: (GraphPad Prism, RRID:SCR_002798)
    The genes in the DEGs directly regulated by transcription factors (FOS, ATF2, MEF2C) were identified based on binding profiles of all public ChIP-seq data for particular gene loci from the ChIP-Atlas database (Oki et al., 2018).
    ChIP-Atlas
    suggested: (ChIP-Atlas, RRID:SCR_015511)

    Results from OddPub: Thank you for sharing your data.

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: We did not find any issues relating to colormaps.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  2. Version published to 10.1101/2021.05.04.442548 on bioRxiv