Convergent antibody responses to the SARS-CoV-2 spike protein in convalescent and vaccinated individuals

  1. Elaine C. Chen
  2. Pavlo Gilchuk
  3. Seth J. Zost
  4. Naveenchandra Suryadevara
  5. Emma S. Winkler
  6. Carly R. Cabel
  7. Elad Binshtein
  8. Rachel E. Sutton
  9. Jessica Rodriguez
  10. Samuel Day
  11. Luke Myers
  12. Andrew Trivette
  13. Jazmean K. Williams
  14. Edgar Davidson
  15. Shuaizhi Li
  16. Benjamin J. Doranz
  17. Samuel K. Campos
  18. Robert H. Carnahan
  19. Curtis A. Thorne
  20. Michael S. Diamond
  21. James E. Crowe

Reviewed by

Read the full article See related articles

Discuss this preprint

Start a discussion What are Sciety discussions?

Listed in

Log in to save this article

Abstract

Unrelated individuals can produce genetically similar clones of antibodies, known as public clonotypes, which have been seen in responses to different infectious diseases as well as healthy individuals. Here we identify 37 public clonotypes in memory B cells from convalescent survivors of SARS-CoV-2 infection or in plasmablasts from an individual after vaccination with mRNA-encoded spike protein. We identified 29 public clonotypes, including clones recognizing the receptor-binding domain (RBD) in the spike protein S1 subunit (including a neutralizing, ACE2-blocking clone that protects in vivo ), and others recognizing non-RBD epitopes that bound the heptad repeat 1 region of the S2 domain. Germline-revertant forms of some public clonotypes bound efficiently to spike protein, suggesting these common germline-encoded antibodies are preconfigured for avid recognition. Identification of large numbers of public clonotypes provides insight into the molecular basis of efficacy of SARS-CoV-2 vaccines and sheds light on the immune pressures driving the selection of common viral escape mutants.

Article activity feed

  1. ScreenIT

    SciScore for 10.1101/2021.05.02.442326: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    EthicsIRB: The studies were approved by the Institutional Review Board of Vanderbilt University Medical Center.
    IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01).
    Sex as a biological variableWe studied one patient (a 59-year-old male) who received Pfizer-BioNTech vaccine.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Cell Line AuthenticationContamination: Mycoplasma testing of cell lines was performed on monthly basis using a PCR-based mycoplasma detection kit (ATCC, 30-1012K), with negative results at each testing.

    Table 2: Resources

    Antibodies
    SentencesResources
    Bound antibodies were detected using goat anti-human IgG conjugated with horseradish peroxidase and TMB substrate.
    anti-human IgG
    suggested: None
    Antibody binding was detected with anti-IgG Alexa-Fluor-647-labelled secondary antibodies.
    anti-IgG Alexa-Fluor-647-labelled secondary antibodies.
    suggested: None
    ACE2 binding was detected using HRP-conjugated anti-FLAG antibodies and developed with TMB substrate.
    anti-FLAG
    suggested: None
    Primary J2 anti-dsRNA (Scicons #10010500) antibody solution at a 1:1,000 dilution was placed on the cells overnight at 4°C.
    anti-dsRNA
    suggested: (SCICONS Cat# 10010200, RRID:AB_2651015)
    Cells were washed with 0.1% Tween-20/PBS (PBST) three times and plates were incubated with secondary goat anti-mouse Alexa-Fluor-546-labeled antibody at 1:1,000 dilution (Thermo Fisher Scientific) for 2 h at room temperature in the dark.
    anti-mouse
    suggested: None
    Enriched cells were stained 30 min on ice in a RoboSep buffer (StemCell Technologies) containing following phenotyping antibodies; anti-CD19-FITC (1:20 dilution, eBioscience), anti-CD27-APC (1:20 dilution), and anti-CD38-PE (1:25 dilution, BD Biosciences), and then analyzed by flow cytometry using an SH800 cell sorter (Sony).
    anti-CD19-FITC
    suggested: (Millipore Cat# FCMAB218F, RRID:AB_10919255)
    anti-CD27-APC
    suggested: (Sigma-Aldrich Cat# SAB4700132, RRID:AB_10896618)
    anti-CD38-PE
    suggested: (Sigma-Aldrich Cat# P6722, RRID:AB_261136)
    ELISpot assay: Direct enzyme-linked immunosorbent spot (ELISpot) assay was performed to enumerate plasmablasts present in the PBMC samples secreting IgG, IgM, or IgA antibodies reacting with either SARS-CoV-2-S6Pecto protein or influenza A/Darwin/42/2020 H1N1 hemagglutinin protein (as a negative control).
    IgA
    suggested: None
    H1N1 hemagglutinin protein
    suggested: None
    Plates were washed with PBS and then PBS containing 0.05% Tween, and then incubated with either goat anti-human IgG-HRP conjugated antibodies (Southern Biotech), goat anti-human IgA-HRP conjugated antibodies (Southern Biotech), or goat anti-human IgM-HRP conjugated antibodies (Southern Biotech) for 2 h at room temperature.
    anti-human IgG-HRP
    suggested: (SouthernBiotech Cat# 2040-05, RRID:AB_2795644)
    anti-human IgM-HRP
    suggested: None
    Plates were washed with PBS and then PBS containing 0.05% Tween, and then incubated with either goat anti-human IgG-HRP conjugated antibodies (Southern Biotech, catalog no. 2040-05), goat anti-human IgA-HRP conjugated antibodies (Southern Biotech, catalog no. 2050-05), or goat anti-human IgM-HRP conjugated antibodies (Southern Biotech, catalog no. 2020-05) for 2 h at room temperature.
    anti-human IgA-HRP
    suggested: (SouthernBiotech Cat# 2050-05, RRID:AB_2687526)
    Experimental Models: Cell Lines
    SentencesResources
    Cell lines: Vero E6 (ATCC, CRL-1586) cells were maintained at 37°C in 5% CO2 in Dulbecco’s minimal essential medium (DMEM) containing 10% heat inactivated fetal bovine serum (FBS), 10 mM HEPES pH 73, 1 mM sodium pyruvate, 1× non-essential amino acids, and 100 U/mL of penicillin-streptomycin.
    Vero E6
    suggested: None
    Calu-3 (ATCC, HTB-55) cells were maintained at 37°C in 5% CO2 in DMEM with high glucose and L-glutamine (Gibco 11965092), containing 10% heat inactivated fetal bovine serum (FBS), and 100 U/mL of penicillin-streptomycin.
    Calu-3
    suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)
    Infectious stocks were propagated by inoculating Vero CCL81 cells.
    Vero CCL81
    suggested: None
    Cell-surface antigen-display assay: Vero cell monolayers were monitored until 80% confluent and then inoculated with VSV-SARS-CoV-2 V (WA1/2020 strain) at an MOI of 0.5 in culture medium (DMEM with 2% FBS).
    Vero
    suggested: None
    A plasmid encoding cDNA for each S protein mutant was transfected into HEK-293T cells and allowed to express for 22 h.
    HEK-293T
    suggested: None
    Experimental Models: Organisms/Strains
    SentencesResources
    Heterozygous K18-hACE c57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) were obtained from The Jackson Laboratory.
    K18-hACE c57BL/6J
    suggested: None
    Software and Algorithms
    SentencesResources
    Heat map generation: All sequences that were identified to be public clonotypes were analyzed with PyIR66 to identify the V and J genes.
    PyIR66
    suggested: None
    These frequency counts then were plotted onto the heatmap using Python Seaborn Library.
    Python
    suggested: (IPython, RRID:SCR_001658)
    Expressed protein was incubated with BioLock (IBA Lifesciences) and then isolated by Strep-tag affinity chromatography on StrepTrap HP columns (GE Healthcare), followed by size-exclusion chromatography on TSKgel G4000SWXL (TOSOH) if needed.
    BioLock
    suggested: None
    Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer:m GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/).
    GACTGCCGCCTCTGCTC
    suggested: None
    Probe
    suggested: (UniPROBE, RRID:SCR_005803)
    Image processing was performed using the cryoSPARC software package.
    cryoSPARC
    suggested: (cryoSPARC, RRID:SCR_016501)
    Enriched cells were stained 30 min on ice in a RoboSep buffer (StemCell Technologies) containing following phenotyping antibodies; anti-CD19-FITC (1:20 dilution, eBioscience), anti-CD27-APC (1:20 dilution), and anti-CD38-PE (1:25 dilution, BD Biosciences), and then analyzed by flow cytometry using an SH800 cell sorter (Sony).
    BD Biosciences
    suggested: (BD Biosciences, RRID:SCR_013311)
    Amplicons were sequenced on an Illumina Novaseq 6000, and data were processed using the CellRanger software v3.1.0 (10X Genomics).
    CellRanger
    suggested: (SCIGA, RRID:SCR_021002)
    Statistical analyses were performed using Prism v8.4.3 (GraphPad).
    Prism
    suggested: (PRISM, RRID:SCR_005375)
    GraphPad
    suggested: (GraphPad Prism, RRID:SCR_002798)

    Results from OddPub: Thank you for sharing your code and data.

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: We did not find any issues relating to colormaps.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    Results from scite Reference Check: We found no unreliable references.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  2. Version published to 10.1101/2021.05.02.442326 on bioRxiv