Interferon-regulated genetic programs and JAK/STAT pathway activate the intronic promoter of the short ACE2 isoform in renal proximal tubules
This article has been Reviewed by the following groups
Listed in
- Evaluated articles (ScreenIT)
Abstract
Recently, a short, interferon-inducible isoform of Angiotensin-Converting Enzyme 2 (ACE2), dACE2 was identified. ACE2 is a SARS-Cov-2 receptor and changes in its renal expression have been linked to several human nephropathies. These changes were never analyzed in context of dACE2 , as its expression was not investigated in the kidney. We used Human Primary Proximal Tubule (HPPT) cells to show genome-wide gene expression patterns after cytokine stimulation, with emphasis on the ACE2/dACE2 locus. Putative regulatory elements controlling dACE2 expression were identified using ChIP-seq and RNA-seq. qRT-PCR differentiating between ACE2 and dACE2 revealed 300- and 600-fold upregulation of dACE2 by IFNα and IFNβ, respectively, while full length ACE2 expression was almost unchanged. JAK inhibitor ruxolitinib ablated STAT1 and dACE2 expression after interferon treatment. Finally, with RNA-seq, we identified a set of genes, largely immune-related, induced by cytokine treatment. These gene expression profiles provide new insights into cytokine response of proximal tubule cells.
Article activity feed
-
SciScore for 10.1101/2021.01.15.426908: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Antibodies used: anti-Trimethyl-Histone H3 (Lys4) (Millipore, CS200580) anti-Trimethyl-Histone H3suggested: NoneLys4suggested: NoneCS200580suggested: NoneExperimental Models: Cell Lines Sentences Resources Data availability: DHS from Human Renal Cortical Epithelial cells and CTCF ChIP-seq from HEK293 cells were obtained under GSE29692 and GSE68976, respectively. HEK293suggested: NoneSoftware and Algorithms Sentences Resources . qRT-PCR reaction was prepared with … SciScore for 10.1101/2021.01.15.426908: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Antibodies used: anti-Trimethyl-Histone H3 (Lys4) (Millipore, CS200580) anti-Trimethyl-Histone H3suggested: NoneLys4suggested: NoneCS200580suggested: NoneExperimental Models: Cell Lines Sentences Resources Data availability: DHS from Human Renal Cortical Epithelial cells and CTCF ChIP-seq from HEK293 cells were obtained under GSE29692 and GSE68976, respectively. HEK293suggested: NoneSoftware and Algorithms Sentences Resources . qRT-PCR reaction was prepared with SsoAdvanced Universal Probes Supermix (Bio-Rad) and following Taqman probes (ThermoFisher): GAPDH (Hs02786624_g1), ACE2 (Hs01085333_m1), TMPRSS2 (Hs01122322_m1) and STAT1 (Hs01013996_m1) (Bio-Rad) or following primers: dACE2 forward: 5’ GGAAGCAGGCTGGGACAAA 3’, dACE2 reverse: 5’ AGCTGTCAGGAAGTCGTCCATT 3’, ACE2 forward: 5’ GGGCGACTTCAGGATCCTTAT 3’, ACE2 reverse: 5’ GGATATGCCCCATCTCATGATG 3’ SsoAdvanced Universal Probessuggested: NoneThe raw data were subjected to QC analyses using the FastQC tool (version 0.11.9) (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/). FastQCsuggested: (FastQC, RRID:SCR_014583)Trimmomatic (version 0.36) (Bolger et al., 2014) was used to assess total RNA-seq read quality and STAR RNA-seq (version 2.5.4a) (Dobin et al., 2013) using 50bp paired-end mode was used to align the reads (hg19). Trimmomaticsuggested: (Trimmomatic, RRID:SCR_011848)STARsuggested: (STAR, RRID:SCR_015899)HTSeq (Anders et al., 2015) was used to retrieve the raw counts and R package DESeq2 (Huber et al., 2015; Love et al., 2014) was used to normalize data. HTSeqsuggested: (HTSeq, RRID:SCR_005514)DESeq2suggested: (DESeq, RRID:SCR_000154)The visualization was done using dplyr (https://CRAN.R-project.org/package=dplyr) and ggplot2 (Risso et al., 2014). ggplot2suggested: (ggplot2, RRID:SCR_014601)Sequence read numbers were calculated using Samtools (Li et al., 2009) software with sorted bam files. Samtoolssuggested: (SAMTOOLS, RRID:SCR_002105)ChIP-seq library preparation and data analysis: Cells were washed twice with PBS and fixed with 0.75% formaldehyde in DMEM for 10 minutes in room temperature. ChIP-seqsuggested: (ChIP-seq, RRID:SCR_001237)DNA was then purified with MinElute PCR Purification Kit (Quiagen) and library preparation was performed according to manufacturer’s instructions for NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (New England Biotechnology) New England Biotechnologysuggested: NonePicard, http://broadinstitute.github.io/picard/. 2016) was used to remove duplicates and subsequently, and Homer(Heinz et al., 2010) Picardsuggested: (Picard, RRID:SCR_006525)Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
-
