Use of alternative RNA storage and extraction reagents and development of a hybrid PCR-based method for SARS-CoV-2 detection

  1. Julie Yang
  2. Elias Salfati
  3. Damian Kao
  4. Yuliana Mihaylova

Reviewed by

Read the full article See related articles

Listed in

Log in to save this article

Abstract

The COVID-19 pandemic has presented multiple healthcare challenges, one of which is adequately meeting the need for large-scale diagnostic testing. The most commonly used assays for detection of SARS-CoV-2, including those recommended by the Center for Disease Control and Prevention (CDC), rely on a consistent set of core reagents. This has put a serious strain on the reagent supply chain, resulting in insufficient testing. It has also led to restricted animal testing, even though there are now multiple reports of animals, particularly cats, ferrets and minks, contracting the disease. We aimed to address the diagnostic bottleneck by developing a PCR-based SARS-CoV-2 detection assay for cats (and, potentially, other animals) which avoids the use of most common reagents, such as collection kits optimized for RNA stabilization, RNA isolation kits and TaqMan-based RT-PCR reagents. We demonstrated that an inexpensive solid-phase reversible immobilization (SPRI) method can be used for RNA extraction from feline samples collected with DNAGenotek’s ORAcollect RNA OR-100 and PERFORMAgene DNA PG-100 sample collection kits, optimized for RNA or DNA stabilization, respectively. We developed a dual method SARS-CoV-2 detection assay relying on SYBR RT-PCR and Sanger sequencing, using the same set of custom synthesized oligo primers. We validated our test’s specificity with a commercially available SARS-CoV-2 plasmid positive control, as well as two in-house positive control RNA samples. Our assay’s sensitivity was determined to be 10 viral copies per reaction. Our results suggest that a simple SPRI-dependent RNA extraction protocol and certain sample collection kits not specifically optimized for RNA stabilization could potentially be used in cases where reagent shortages are hindering adequate COVID-19 testing. These ‘alternative’ reagents could be used in combination with our COVID-19 testing method, which relies on inexpensive and readily available SYBR RT-PCR and non-fluorescent PCR reagents. Depending on the detection goals and the laboratory setup available, the SYBR RT-PCR method and the Sanger sequencing based method can be used alone or in conjunction, for improved accuracy. Although the test is intended for animal use, it is, in theory, possible to use it with human samples, especially those with higher viral loads.

Article activity feed

  1. ScreenIT

    SciScore for 10.1101/2020.11.21.20236216: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    Institutional Review Board Statementnot detected.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Sex as a biological variablenot detected.

    Table 2: Resources

    Software and Algorithms
    SentencesResources
    Custom primers: We designed the following primer pair amplifying 328 bp of the N region of the SARS-CoV-2 genome: COVID_FP: CAACTGAGGGAGCCTTGAATAC COVID_RP: CCTTGTTGTTGTTGGCCTTTAC RT-PCR: We used AppliedBiosystems’ PowerUp™
    AppliedBiosystems’
    suggested: None
    VirDetect begins by aligning RNA-seq reads to the feline genome12 using the STARv2.4 aligner13.
    STARv2.4
    suggested: None

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

    Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
    One potential caveat is that, since long-term RNA preservation with the PERFORMAgene DNA PG-100 was not tested, samples collected in this manner should probably undergo rapid processing (within 24 hours) in order to maximize chances of successful viral detection. During the COVID-19 pandemic, RT-PCR machines and TaqMan probe-based RT-PCR reagents can be costly and in short supply. As an alternative, we developed an assay that relies on SYBR RT-PCR and Sanger sequencing. Each of those two methodologies can be used in isolation, depending on preference and the purpose of testing. If the test is used in COVID-19 outbreak areas, the quicker SYBR RT-PCR version can be employed (results within 1 day), which does not distinguish between SARS-CoV and SARS-CoV-2. The rationale in such a scenario is that it is highly unlikely for SARS-CoV to be present in a COVID-19 affected area. For a more definitive answer where a clear distinction between SARS-CoV and SARS-CoV-2 is required, the Sanger sequencing version of our assay should be used alone or in combination with the SYBR RT-PCR (results within 2 days). Our test’s sensitivity is 10 viral copies per reaction. Human patients’ SARS-CoV-2 viral loads in nasopharyngeal and oropharyngeal samples typically vary between 1.9 and 8 log10 RNA copies/ml9, which corresponds to a range between 0.395 and >5000 viral copies per reaction volume as defined in our assay. While not much data is available on the comparative viral loads in COVID-19 positiv...

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: We did not find any issues relating to colormaps.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  2. Version published to 10.1101/2020.11.21.20236216 on medRxiv