SARS-CoV-2 Infects Human Engineered Heart Tissues and Models COVID-19 Myocarditis

This article has been Reviewed by the following groups

Read the full article See related articles

Discuss this preprint

Start a discussion What are Sciety discussions?

Abstract

Epidemiological studies of the COVID-19 pandemic have revealed evidence of cardiac involvement and documented that myocardial injury and myocarditis are predictors of poor outcomes. Nonetheless, little is understood regarding SARS-CoV-2 tropism within the heart and whether cardiac complications result directly from myocardial infection. Here, we develop a human engineered heart tissue model and demonstrate that SARS-CoV-2 selectively infects cardiomyocytes. Viral infection is dependent on expression of angiotensin-I converting enzyme 2 (ACE2) and endosomal cysteine proteases, suggesting an endosomal mechanism of cell entry. After infection with SARS-CoV-2, engineered tissues display typical features of myocarditis, including cardiomyocyte cell death, impaired cardiac contractility, and innate immune cell activation. Consistent with these findings, autopsy tissue obtained from individuals with COVID-19 myocarditis demonstrated cardiomyocyte infection, cell death, and macrophage-predominate immune cell infiltrate. These findings establish human cardiomyocyte tropism for SARS-CoV-2 and provide an experimental platform for interrogating and mitigating cardiac complications of COVID-19.

Article activity feed

  1. SciScore for 10.1101/2020.11.04.364315: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    Institutional Review Board StatementIRB: Human atrial tissue samples: The study protocol involving human tissue samples was approved by the ethics committees of the Medical Faculty of Heidelberg University (Germany; S-017/2013).
    Consent: Written informed consent was obtained from all patients and the study was conducted in accordance with the Declaration of Helsinki.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Sex as a biological variablenot detected.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Antibodies
    SentencesResources
    Plates were incubated overnight at 4°C in 100 μL of permeabilization buffer containing 1 μg/mL of the CR3022 anti-spike monoclonal antibody52.
    CR3022
    suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)
    anti-spike
    suggested: None
    antibody52
    suggested: None
    Following washing, 50 μL of goat anti-human secondary antibody conjugated to HRP (Sigma AP504P), diluted 1:1000 in permeabilization buffer, was added for 2 hours at room temperature with shaking.
    goat anti-human secondary antibody
    suggested: None
    anti-human secondary
    suggested: None
    Arterial endothelium was identified as CD34+CD184+CD73+ cells using appropriate antibodies (BD Biosciences, anti-CD34 PE-Cy7 [cat # 560710], anti-CD184 APC [cat #560936], anti-CD73 PE [cat #550257]) and isolated by flow cytometric cell sorting on a BD FACSAriaII.
    anti-CD34
    suggested: (BD Biosciences Cat# 560710, RRID:AB_1727470)
    anti-CD184 APC
    suggested: None
    anti-CD73 PE
    suggested: (BD Biosciences Cat# 550257, RRID:AB_393561)
    , anti-CD45 FITC (cat #304006), and anti-CD31 BV421 (cat #303124) (all antibodies from Biolegend).
    anti-CD45 FITC
    suggested: (BioLegend Cat# 304006, RRID:AB_314394)
    anti-CD31 BV421
    suggested: (BioLegend Cat# 303124, RRID:AB_2563810)
    Primary antibodies (rabbit anti Troponin T, 1:400, Abcam, ab45932) were added for 1-2 hours at room temperature or overnight at 4 °C.
    rabbit anti Troponin T
    suggested: None
    anti Troponin T
    suggested: None
    Cells were then washed with PBS before incubating for 1 hour in secondary antibody (Cy3 donkey anti-rabbit, Jackson Immunoresearch, 711165152). 4′,6-diamidino-2-phenylindole (DAPI) was used at a 1:50000 dilution to stain for nuclei.
    Cy3 donkey anti-rabbit , Jackson Immunoresearch , 711165152) . 4′,6-diamidino-2-phenylindole
    suggested: None
    Primary antibodies against human sarcomeric actin (Sigma A2127), human Troponin T (ThermoFisher MS-295-P1), human CD68 (BioRad MCA5709)
    human sarcomeric actin
    suggested: None
    human CD68
    suggested: (Bio-Rad Cat# MCA5709, RRID:AB_11152768)
    Experimental Models: Cell Lines
    SentencesResources
    Infectious stocks were grown by inoculating Vero CCL81 cells and collecting supernatant upon observation of cytopathic effect.
    Vero CCL81
    suggested: None
    Focus forming assay: Vero E6 cells were seeded at a density of 4×104 cells per well in flat-bottom 96-well tissue culture plates.
    Vero E6
    suggested: None
    Software and Algorithms
    SentencesResources
    Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/).
    GACTGCCGCCTCTGCTC
    suggested: None
    Probe
    suggested: (UniPROBE, RRID:SCR_005803)
    The DESeq2 package utilizes negative binominal distribution to model the distribution of RNA-Seq reads, and uses Wald test to calculate p-values54.
    DESeq2
    suggested: (DESeq, RRID:SCR_000154)
    Analysis was performed using FlowJo 10.6.1
    FlowJo
    suggested: (FlowJo, RRID:SCR_008520)
    We wrote a custom script in MATLAB to calculate the displacement of the posts as a function of time.
    MATLAB
    suggested: (MATLAB, RRID:SCR_001622)
    Images were collected on a confocal microscope (Zeiss LSM 700 Laser Scanning Confocal) and processed using ZenBlack (Zeiss) and ImageJ (NCBI).
    ImageJ
    suggested: (ImageJ, RRID:SCR_003070)
    Basecalls and demultiplexing were performed with Illumina’s bcl2fastq software and a custom python demultiplexing program with a maximum of one mismatch in the indexing read.
    Illumina’s
    suggested: None
    bcl2fastq
    suggested: (bcl2fastq , RRID:SCR_015058)
    RNA-seq reads were then aligned to the Human Ensembl GRCh38.76 primary assembly and SARS-CoV-2 NCBI NC_045512 Wuhan-Hu-1 genome with STAR version 2.5.1a63.
    STAR
    suggested: (STAR, RRID:SCR_015899)
    Isoform expression of known Ensembl transcripts were estimated with Salmon version 0.8.265.
    Salmon
    suggested: (Salmon, RRID:SCR_017036)
    The ribosomal fraction, known junction saturation, and read distribution over known gene models were quantified with RSeQC version 2.6.266.
    RSeQC
    suggested: (RSeQC, RRID:SCR_005275)
    Perturbed KEGG pathways where the observed log 2 fold-changes of genes within the term were significantly perturbed in a single-direction versus background or in any direction compared to other genes within a given term with p-values less than or equal to 0.05 were rendered as nnotated KEGG graphs with the R/Bioconductor package Pathview72.
    KEGG
    suggested: (KEGG, RRID:SCR_012773)
    To find the most critical genes, the raw counts were variance stabilized with the R/Bioconductor package DESeq254 and then analyzed via weighted gene correlation network analysis with the R/Bioconductor package WGCNA73.
    R/Bioconductor
    suggested: None
    Significant terms with Benjamini-Hochberg adjusted p-values less than 0.05 were then collapsed by similarity into clusterProfiler category network plots to display the most significant terms for each module of hub genes in order to interpolate the function of each significant module.
    clusterProfiler
    suggested: (clusterProfiler, RRID:SCR_016884)
    The information for all clustered genes for each module were combined with their respective statistical significance results from Limma to identify differentially expressed genes.
    Limma
    suggested: (LIMMA, RRID:SCR_010943)
    Statistical significance was assigned when P values were < 0.05 using Prism Version 8 (GraphPad).
    GraphPad
    suggested: (GraphPad Prism, RRID:SCR_002798)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


    Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
    Despite these limitations, our findings clearly demonstrate that cardiomyocytes are a target of SARS-CoV-2 infection. Consistent with this conclusion, examination of human autopsy and endomyocardial biopsy tissue obtained from four patients with clinical diagnoses of COVID-19 myocarditis revealed evidence of myocardial SARS-CoV-2 RNA and protein predominately within cardiomyocytes and accumulation of macrophages in areas surrounding myocardial injury. These findings are consistent with prior reports highlighting infiltration of monocytes, lymphocytes, and plasma cells in an endomyocardial biopsy specimen from a patient with suspected COVID-19 myocarditis35 and viral RNA within the myocardium of COVID-19 autopsy specimens36. It is important to note that the human specimens examined in this study differ substantially from published autopsy series that did not include subjects with cardiac manifestations 3,37. Here, we exclusively focused on subjects with active COVID-19 infection and clinical evidence of myocarditis based on echocardiography and clinical presentation. Numerous studies have reported that extrapulmonary cell types are susceptible to SARS-CoV-2 infection38–40. This broader cellular tropism appears to be dictated by ACE2 expression and the ability of the virus to gain access to extrapulmonary tissues. Among cell types within the heart, cardiomyocytes and pericytes express ACE2 mRNA17. Our immunostaining studies of human heart samples and EHTs suggest that ACE2 prot...

    Results from TrialIdentifier: No clinical trial numbers were referenced.


    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


    Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 49, 59, 61 and 57. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.