SARS-CoV-2 viroporin triggers the NLRP3 inflammatory pathway

  1. Huanzhou Xu
  2. Siddhi A. Chitre
  3. Ibukun A. Akinyemi
  4. Julia C. Loeb
  5. John A. Lednicky
  6. Michael T. McIntosh
  7. Sumita Bhaduri-McIntosh

Reviewed by

Read the full article See related articles

Listed in

Log in to save this article

Abstract

Cytokine storm resulting from a heightened inflammatory response is a prominent feature of severe COVID-19 disease. This inflammatory response results from assembly/activation of a cell-intrinsic defense platform known as the inflammasome. We report that the SARS-CoV-2 viroporin encoded by ORF3a activates the NLRP3 inflammasome, the most promiscuous of known inflammasomes. ORF3a triggers IL-1β expression via NFκB, thus priming the inflammasome while also activating it via ASC-dependent and -independent modes. ORF3a-mediated inflammasome activation requires efflux of potassium ions and oligomerization between NEK7 and NLRP3. With the selective NLRP3 inhibitor MCC950 able to block ORF3a-mediated inflammasome activation and key ORF3a residues needed for virus release and inflammasome activation conserved in SARS-CoV-2 isolates across continents, ORF3a and NLRP3 present prime targets for intervention.

Summary

Development of anti-SARS-CoV-2 therapies is aimed predominantly at blocking infection or halting virus replication. Yet, the inflammatory response is a significant contributor towards disease, especially in those severely affected. In a pared-down system, we investigate the influence of ORF3a, an essential SARS-CoV-2 protein, on the inflammatory machinery and find that it activates NLRP3, the most prominent inflammasome by causing potassium loss across the cell membrane. We also define key amino acid residues on ORF3a needed to activate the inflammatory response, and likely to facilitate virus release, and find that they are conserved in virus isolates across continents. These findings reveal ORF3a and NLRP3 to be attractive targets for therapy.

Article activity feed

  1. ScreenIT

    SciScore for 10.1101/2020.10.27.357731: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    Institutional Review Board Statementnot detected.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Sex as a biological variablenot detected.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Antibodies
    SentencesResources
    RT-PCR primers were as following: forward primer 5’ACCATCTTCCAGGAGCGAGA3’ and reverse primer 5’GGCCATCCACAGTCTTCTGG 3’ for GAPDH mRNA, forward primer 5’TCAGCCAATCTTCATTGCTC3’ and reverse primer 5’GCCATCAGCTTCAAAGAACA3’ for IL-1β pre-mRNA 2 Immunoblotting and antibodies: Immunoblotting was performed as previously described 3.
    GAPDH
    suggested: None
    The following antibodies were used: rabbit anti-Caspase-1 antibody (Thermo Scientific, Cat.
    anti-Caspase-1
    suggested: None
    , rabbit anti-cleaved Caspase-1 antibody (Thermo Scientific, Cat.
    anti-cleaved Caspase-1
    suggested: None
    mouse anti-IL-1β (Cell Signaling Technology, Cat. 12242s), mouse anti-Flag M2 antibody (Sigma-Aldrich, Cat.
    anti-IL-1β ( Cell Signaling Technology , Cat. 12242s)
    suggested: (Cell Signaling Technology Cat# 12242, RRID:AB_2715503)
    anti-Flag
    suggested: None
    F1804), mouse anti-β-actin antibody (Sigma-Aldrich, Cat. A5441), rabbit anti-phospho-IκBα (Ser32) antibody (Cell Signaling Technology, Cat. 2859s), rabbit anti-IκBα antibody (Cell Signaling Technology, Cat. 9242s)
    anti-β-actin
    suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)
    anti-phospho-IκBα
    suggested: None
    Ser32
    suggested: (Cell Signaling Technology Cat# 2859, RRID:AB_561111)
    anti-IκBα
    suggested: (Active Motif Cat# 40904, RRID:AB_2793427)
    , rabbit anti-NF-κB p65 antibody (Cell Signaling Technology, Cat. 8242s), rabbit anti-Caspase 3 antibody (GeneTex, Cat. GTX110543), rabbit anti-Gasdermin D (L60) antibody (Cell Signaling Technology, Cat. 93709s), rabbit anti-cleaved-Gasdermin D (Asp275) antibody (Cell Signaling Technology, Cat. 36425s), rabbit anti-NLRP3 antibody (Invitrogen, Cat. PA5-21745), rabbit anti-NEK7 antibody (Cell Signaling Technology, Cat. 3057s), rabbit anti-ASC antibody (Cell Signaling Technology, Cat. 13833s), rabbit anti-NLRP1 antibody (Novus Biologicals, Cat. NB100-56147SS), rabbit anti-NLRC4 antibody (Novus Biologicals, Cat. NB100-56142SS), rabbit anti-SARS-CoV-2 ORF3a antibody (FabGennix, Cat. SARS-COV2-ORF3A-101AP)
    anti-NF-κB
    suggested: (Cell Signaling Technology Cat# 8242, RRID:AB_10859369)
    anti-Caspase 3
    suggested: (GeneTex Cat# GTX110543, RRID:AB_10722709)
    anti-Gasdermin D ( L60
    suggested: None
    anti-cleaved-Gasdermin D
    suggested: None
    Asp275
    suggested: (Cell Signaling Technology Cat# 36425, RRID:AB_2799099)
    anti-NLRP3
    suggested: (Thermo Fisher Scientific Cat# PA5-21745, RRID:AB_11154334)
    anti-ASC
    suggested: None
    anti-NLRP1
    suggested: None
    anti-NLRC4
    suggested: None
    anti-SARS-CoV-2
    suggested: None
    The rest was incubated with 3.0 μg of rabbit anti-NEK7 antibody (Bethyl Laboratories, Cat. A302-684A) or the same amount of control IgG (R&D, Cat. AB-105-C) together with 40 μl of Dynabeads Protein G (Thermo Scientific, Cat. 10003D) at 4 °C overnight.
    anti-NEK7
    suggested: (Bethyl Cat# A302-684A, RRID:AB_10753210)
    Experimental Models: Cell Lines
    SentencesResources
    HEK-293T and A549 cells were transfected with LipoJet™ In Vitro Transfection Kit (SignaGen Laboratories, SL100468) according to the manufacturer’s protocol.
    HEK-293T
    suggested: None
    This virus was isolated and then propagated (one passage) in VeroE6 cells prior to sequence analyses and use in this work, and has no INDELs in its genome.
    VeroE6
    suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)
    Briefly, A549 cells were transfected with FLAG-ORF3a or empty vector as control.
    A549
    suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

    Results from JetFighter: We did not find any issues relating to colormaps.

    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  2. Version published to 10.1101/2020.10.27.357731 on bioRxiv