Structural and Functional Comparison of SARS-CoV-2-Spike Receptor Binding Domain Produced in Pichia pastoris and Mammalian Cells

Abstract

The yeast Pichia pastoris is a cost-effective and easily scalable system for recombinant protein production. In this work we compared the conformation of the receptor binding domain (RBD) from SARS-CoV-2 Spike protein expressed in P. pastoris and in the well established HEK-293T mammalian cell system. RBD obtained from both yeast and mammalian cells was properly folded, as indicated by UV-absorption, circular dichroism and tryptophan fluorescence. They also had similar stability, as indicated by temperature-induced unfolding (observed T _m were 50 °C and 52 °C for RBD produced in P. pastoris and HEK-293T cells, respectively). Moreover, the stability of both variants was similarly reduced when the ionic strength was increased, in agreement with a computational analysis predicting that a set of ionic interactions may stabilize RBD structure. Further characterization by HPLC, size-exclusion chromatography and mass spectrometry revealed a higher heterogeneity of RBD expressed in P. pastoris relative to that produced in HEK-293T cells, which disappeared after enzymatic removal of glycans. The production of RBD in P. pastoris was scaled-up in a bioreactor, with yields above 45 mg/L of 90% pure protein, thus potentially allowing large scale immunizations to produce neutralizing antibodies, as well as the large scale production of serological tests for SARS-CoV-2.

SciScore for 10.1101/2020.09.17.300335: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

Institutional Review Board Statement	IRB: STAN No. 4482), under ISO9001 guidelines and those from the Institutional Committee for the Care and Use of Laboratory Animals (CICUAL).
Randomization	not detected.
Blinding	not detected.
Power Analysis	not detected.
Sex as a biological variable	Female mice (6-8 week-old) were immunized intraperitoneally with 40 µg RBD protein produced in P. pastoris in the presence of the HPLC-grade phosphorothioate oligonucleotide CpG-ODN 1826 (5’ TCCATGACGTTCCTGACGTT 3’) (20 µg/mouse/dose) (Oligos etc. Inc.
Cell Line Authentication	not detected.

Table 2: Resources

…

Antibodies
Sentences	Resources
RBD expression was confirmed by Western blot analysis using anti-RBD and anti-his antibodies.

SciScore for 10.1101/2020.09.17.300335: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

Institutional Review Board Statement	IRB: STAN No. 4482), under ISO9001 guidelines and those from the Institutional Committee for the Care and Use of Laboratory Animals (CICUAL).
Randomization	not detected.
Blinding	not detected.
Power Analysis	not detected.
Sex as a biological variable	Female mice (6-8 week-old) were immunized intraperitoneally with 40 µg RBD protein produced in P. pastoris in the presence of the HPLC-grade phosphorothioate oligonucleotide CpG-ODN 1826 (5’ TCCATGACGTTCCTGACGTT 3’) (20 µg/mouse/dose) (Oligos etc. Inc.
Cell Line Authentication	not detected.

Table 2: Resources

Antibodies
Sentences	Resources
RBD expression was confirmed by Western blot analysis using anti-RBD and anti-his antibodies.	anti-RBD suggested: None anti-his suggested: None
Experimental Models: Cell Lines
Sentences	Resources
Expression of RBD was carried out in the HEK-293T cell line kindly provided by Xavier Saelens (VIB-University of Ghent, Belgium).	HEK-293T suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)
Experimental Models: Organisms/Strains
Sentences	Resources
BALB/c mice were obtained from the animal facility of the Faculty of Veterinary Sciences, University of La Plata (Argentina), and housed at the animal facility of the Instituto de Ciencia y Tecnología Dr. César Milstein, Fundación Pablo Cassará.	BALB/c suggested: RRID:IMSR_ORNL:BALB/cRl)
Software and Algorithms
Sentences	Resources
Multiple sequence alignment was obtained using MAFFT v.745342.	MAFFT suggested: (MAFFT, RRID:SCR_011811)
The RBD region was extracted with the EMBOSS package43 using the RBD region of Uniprot accession QHN73795.	EMBOSS suggested: (EMBOSS, RRID:SCR_008493)
Protein identity analysis was performed by BLAST using the RBD protein sequence as a query and an e-value of 0.001 was used.	BLAST suggested: (BLASTX, RRID:SCR_001653)
The resulting MS/MS spectra were analyzed using the MASCOT search engine44 (Matrix Science) program and COMET45 at Transproteomic Pipeline.	MASCOT suggested: (Mascot, RRID:SCR_014322)
The accessible surface area calculations for the residues of RBD was done using the GetArea server http://curie.utmb.edu/getarea.html using a 1.4 Å probe radius.	GetArea suggested: None

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

Results from TrialIdentifier: No clinical trial numbers were referenced.

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

Results from JetFighter: We did not find any issues relating to colormaps.

Results from rtransparent:

Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
No protocol registration statement was detected.

Read the original source

Structural and Functional Comparison of SARS-CoV-2-Spike Receptor Binding Domain Produced in Pichia pastoris and Mammalian Cells

This article has been Reviewed by the following groups

Listed in

Abstract

Article activity feed

Strength of evidence

Roslyn Bill

Tom Gallagher