SARS-CoV-2 infection in the lungs of human ACE2 transgenic mice causes severe inflammation, immune cell infiltration, and compromised respiratory function
This article has been Reviewed by the following groups
Listed in
- Evaluated articles (ScreenIT)
Abstract
Severe Acute Respiratory Syndrome Coronavirus -2 (SARS-CoV-2) emerged in late 2019 and has spread worldwide resulting in the Coronavirus Disease 2019 (COVID-19) pandemic. Although animal models have been evaluated for SARS-CoV-2 infection, none have recapitulated the severe lung disease phenotypes seen in hospitalized human cases. Here, we evaluate heterozygous transgenic mice expressing the human ACE2 receptor driven by the epithelial cell cytokeratin-18 gene promoter (K18-hACE2) as a model of SARS-CoV-2 infection. Intranasal inoculation of SARS-CoV-2 in K18-hACE2 mice results in high levels of viral infection in lung tissues with additional spread to other organs. Remarkably, a decline in pulmonary function, as measured by static and dynamic tests of respiratory capacity, occurs 4 days after peak viral titer and correlates with an inflammatory response marked by infiltration into the lung of monocytes, neutrophils, and activated T cells resulting in pneumonia. Cytokine profiling and RNA sequencing analysis of SARS-CoV-2-infected lung tissues show a massively upregulated innate immune response with prominent signatures of NF-kB-dependent, type I and II interferon signaling, and leukocyte activation pathways. Thus, the K18-hACE2 model of SARS-CoV-2 infection recapitulates many features of severe COVID-19 infection in humans and can be used to define the mechanistic basis of lung disease and test immune and antiviral-based countermeasures.
Article activity feed
-
SciScore for 10.1101/2020.07.09.196188: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01). Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Cells were incubated with antibodies against the following markers: AF700 anti-CD45 (clone 30 F-11), APC-Cy7 anti-CD11c (clone N418), anti-CD45suggested: (SouthernBiotech Cat# 9624-30, RRID:AB_2797019)anti-CD11csuggested: NoneExperimental Models: Cell Lines Sentences Resources Cells and viruses: Vero E6 … SciScore for 10.1101/2020.07.09.196188: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01). Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Cells were incubated with antibodies against the following markers: AF700 anti-CD45 (clone 30 F-11), APC-Cy7 anti-CD11c (clone N418), anti-CD45suggested: (SouthernBiotech Cat# 9624-30, RRID:AB_2797019)anti-CD11csuggested: NoneExperimental Models: Cell Lines Sentences Resources Cells and viruses: Vero E6 (CRL-1586, American Type Culture Collection (ATCC), Vero CCL81 (ATCC), and Vero-furin cells42 were cultured at 37°C in Dulbecco’s Modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 10 mM HEPES pH 7.3, 1 mM sodium pyruvate, 1× non-essential amino acids, and 100 U/ml of penicillin–streptomycin. Vero E6suggested: NoneVero CCL81suggested: NoneExperimental Models: Organisms/Strains Sentences Resources Heterozygous K18-hACE c57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) were obtained from The Jackson Laboratory. K18-hACE c57BL/6Jsuggested: NoneHomogenates then were analyzed for cytokines and chemokines by Eve Technologies Corporation (Calgary, AB, Canada) using their Mouse Cytokine Array / Chemokine Array 44-Plex (MD44) platform. ABsuggested: NoneSoftware and Algorithms Sentences Resources Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/). GACTGCCGCCTCTGCTCsuggested: NoneProbesuggested: (UniPROBE, RRID:SCR_005803)Probes specifically targeting hACE2 (cat no. 848151) or SARS-CoV-2 S sequence (cat no 848561) were hybridized followed by proprietary signal amplification and detection with 3,3’-Diaminobenzidine. Probessuggested: (ProbeSelect, RRID:SCR_012965)Flow cytometry data were acquired on a cytometer (BD-X20; BD Biosciences) and analyzed using FlowJo software (Tree Star). FlowJosuggested: (FlowJo, RRID:SCR_008520)RNA-seq reads were aligned to the mouse Ensembl GRCh38.76 primary assembly and SARS-CoV-2 NCBI NC_045512 Wuhan-Hu-1 genome with STAR program (version 2.5.1a)44. STARsuggested: (STAR, RRID:SCR_015899)The ribosomal fraction, known junction saturation, and read distribution over known gene models were quantified with RSeQC (version 2.6.2)46. RSeQCsuggested: (RSeQC, RRID:SCR_005275)Statistical analysis: Statistical significance was assigned when P values were < 0.05 using Prism Version 8 (GraphPad) and specific tests are indicated in the Figure legends. GraphPadsuggested: (GraphPad Prism, RRID:SCR_002798)Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:While SARS-CoV-2 lung infection in K18-hACE2 mice provides a model for studying severe infection that recapitulates features of COVID-19 in humans, we acknowledge several limitations. The expression of the hACE2 transgene is non-physiological in several respects. It is driven by a non-native (i.e., the cytokeratin-18) promotor, resulting in tissue expression levels that are distinct from endogenously-expressed ACE2. ACE2 expression in K18-hACE2 mice is independent of the complex regulatory systems that governs ACE2 levels41. As such, comorbid conditions (e.g., obesity, hypertension, diabetes) that alter ACE2 expression in humans41 likely cannot be modelled faithfully in this transgenic mouse. In summary, we found that SARS-CoV-2 infection of K18-hACE2 transgenic mice supports robust viral replication in the lung, which leads to severe immune cell infiltration, inflammation, and pulmonary disease. Thus, the K18-hACE2 mouse is an attractive small animal model for defining the mechanisms of the pathogenesis of severe COVID-19 and may be useful for evaluating countermeasures that reduce virus infection or associated pathological inflammatory responses.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
-
