Orthogonal genome-wide screenings in bat cells identify MTHFD1 as a target of broad antiviral therapy

  1. Danielle E Anderson
  2. Jin Cui
  3. Qian Ye
  4. Baoying Huang
  5. Wenhong Zu
  6. Jing Gong
  7. Weiqiang Liu
  8. So Young Kim
  9. Biao Guo Yan
  10. Kristmundur Sigmundsson
  11. Xiao Fang Lim
  12. Fei Ye
  13. Peihua Niu
  14. Xuming Zhou
  15. Wenjie Tan
  16. Lin-Fa Wang
  17. Xu Tan

Reviewed by

Read the full article See related articles

Discuss this preprint

Start a discussion What are Sciety discussions?

Listed in

Log in to save this article

Abstract

Bats are responsible for the zoonotic transmission of several major viral diseases including the 2003 SARS outbreak and the ongoing COVID-19 pandemic. While bat genomic sequencing studies have revealed characteristic adaptations of the innate immune system, functional genomic studies are urgently needed to provide a foundation for the molecular dissection of the tolerance of viral infections in bats. Here we report the establishment and screening of genome-wide RNAi library and CRISPR library for the model megabat, Pteropus Alecto . We used the complementary RNAi and CRISPR libraries to interrogate Pteropus Alecto cells for infection with two different viruses, mumps virus and Influenza A virus, respectively. Screening results converged on the endocytosis pathway and the protein secretory pathway as required for both viral infections. Additionally, we revealed a general dependence of the C-1-tetrahydrofolate synthase gene, MTHFD1, for viral replication in bat cells as well as in human cells. MTHFD1 inhibitor carolacton potently blocked replication of several RNA viruses including SARS-CoV-2. Our studies provide a resource for systematic inquiry into the genetic underpinnings of bat biology and a potential target for developing broad spectrum antiviral therapy.

Article activity feed

  1. ScreenIT

    SciScore for 10.1101/2020.03.29.014209: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    Institutional Review Board Statementnot detected.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Sex as a biological variablenot detected.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Antibodies
    SentencesResources
    The following antibodies were used in this study: anti-MTHFD1 (Proteintech, 10794-1-AP), anti-beta actin (Easybio, BE0022), anti PR8 M1 (Genetex, GTX125928-S), anti HA (H1N1) (Genetex, GTX117951-S)
    anti-MTHFD1
    suggested: (Proteintech Cat# 10794-1-AP, RRID:AB_2147391)
    GTX125928-S
    suggested: None
    H1N1
    suggested: None
    GTX117951-S
    suggested: None
    ), anti-ZIKV NS1 (Genetex, GTX133307), anti flavivirus group antigen antibody (Millipore, MAB10216).
    anti-ZIKV NS1
    suggested: None
    anti flavivirus group antigen antibody
    suggested: None
    The primers for target genes were as follows: Human GAPDH forward primer: 5’-ACAACTTTGGTATCGTGGAAGG-3’ Human GAPDH reverse primer: 5’ – GCCATCACGCCACAGTTTC-3’ P. alecto ACTIN forward primer: 5’ – gccagtctacaccgtctgcag −3’ P. alecto ACTIN reverse primer: 5’ – cgtaggaatccttctggcccatg-3’ P. alecto MTHFD1 forward primer: 5’- gggagcgactgaagaaccaag-3’ P. alecto MTHFD1 reverse primer: 5’- tcttcagcagccttcagcttcac-3’ P. alecto SEC23B forward primer: 5’- cagcgtttgaccaggaggcc-3’ P. alecto SEC23B reverse primer: 5’- gggtcagatcctgtcgggc −3’ P. alecto GAPDH forward primer: 5’- ATACTTCTCATGGTTCACAC −3’ P. alecto GAPDH reverse primer: 5’ – TCATTGACCTCAACTACATG-3’ P. alecto ATP6V0D1 forward primer: 5’ – GTGGTAGAGTTCCGCCACAT-3’ P. alecto ATP6V0D1 reverse primer: 5’ – CTCAAAGCTGCCTAGTGGGT-3’ PR8 M1 forward primer: 5’ – TTCTAACCGAGGTCGAAACGTACG-3’ PR8 M1 reserve primer: 5’- ACAAAGCGTCTACGCTGCAG-3’ PR8 vRNA reserve transcription primer: 5’-AGCRAAAGCAGG-3’ ZIKV NS5 forward primer: 5’- GGTCAGCGTCCTCTCTAATAAACG-3’ ZIKV NS5 reserve primer: 5’- GCACCCTAGTGTCCACTTTTTCC-3’ Immunofluorescence: Virus infected cells were fixed with 4% paraformaldehyde (PFA) for 10min at room temperature (RT), and permeated with 0.2% Triton X-100 for another 10min at RT, the cells were washed with PBS for 3 times and incubated with PR8 HA antibody or ZIKV E protein antibody for 2h at RT or 4 °C overnight, then washed with PBS for 3 times and incubated with second antibody AF488 (goat anti mouse).
    anti mouse).
    suggested: None
    Experimental Models: Cell Lines
    SentencesResources
    Cells and virus: PaKi, Vero and 293T cells were cultured in DMEM supplemented with 10% heat inactivated FBS.
    293T
    suggested: None
    Mumps virus was propagated in PaKi or Vero cells.
    Vero
    suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)
    Software and Algorithms
    SentencesResources
    Samtools4 (version 1.9) was used to process the alignment files to retain perfectly mapped reads only, and a custom-made Python script was used to count the reads mapped to each guide.
    Python
    suggested: (IPython, RRID:SCR_001658)
    The reads count of guide for each condition were then normalized using DEseq2.
    DEseq2
    suggested: (DESeq2, RRID:SCR_015687)
    The specificity was tested by BLAST (NCBI).
    BLAST
    suggested: (BLASTX, RRID:SCR_001653)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 22 and 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

    Results from rtransparent:
    • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  2. Version published to 10.1101/2020.03.29.014209 on bioRxiv