Orthogonal genome-wide screens of bat cells identify MTHFD1 as a target of broad antiviral therapy

  1. Danielle E. Anderson
  2. Jin Cui
  3. Qian Ye
  4. Baoying Huang
  5. Ya Tan
  6. Chao Jiang
  7. Wenhong Zu
  8. Jing Gong
  9. Weiqiang Liu
  10. So Young Kim
  11. Biao Guo Yan
  12. Kristmundur Sigmundsson
  13. Xiao Fang Lim
  14. Fei Ye
  15. Peihua Niu
  16. Aaron T. Irving
  17. Haoyu Zhang
  18. Yefeng Tang
  19. Xuming Zhou
  20. Yu Wang
  21. Wenjie Tan
  22. Lin-Fa Wang
  23. Xu Tan

Reviewed by

Read the full article

Listed in

Log in to save this article

Abstract

We established a genome-wide CRISPR library and a genome-wide RNA interference library for a bat species and performed two genetic screens to uncover host factors of bat cells involved in virus infections. Although the viruses and methodologies used were different in the two screens, we identified one common protein, MTHFD1, as a broad-spectrum host factor. Further studies show that the MTHFD1 inhibitor, carolacton, can potently inhibit a variety of viruses, including SARS-CoV-2. We provide a resource for studying the functional genomics of bat biology.

Article activity feed

  1. Version published to 10.1073/pnas.2104759118
  2. ScreenIT

    SciScore for 10.1101/2020.03.29.014209: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    Institutional Review Board Statementnot detected.
    Randomizationnot detected.
    Blindingnot detected.
    Power Analysisnot detected.
    Sex as a biological variablenot detected.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Antibodies
    SentencesResources
    The following antibodies were used in this study: anti-MTHFD1 (Proteintech, 10794-1-AP), anti-beta actin (Easybio, BE0022), anti PR8 M1 (Genetex, GTX125928-S), anti HA (H1N1) (Genetex, GTX117951-S)
    anti-MTHFD1
    suggested: (Proteintech Cat# 10794-1-AP, RRID:AB_2147391)
    GTX125928-S
    suggested: None
    H1N1
    suggested: None
    GTX117951-S
    suggested: None
    ), anti-ZIKV NS1 (Genetex, GTX133307), anti flavivirus group antigen antibody (Millipore, MAB10216).
    anti-ZIKV NS1
    suggested: None
    anti flavivirus group antigen antibody
    suggested: None
    The primers for target genes were as follows: Human GAPDH forward primer: 5’-ACAACTTTGGTATCGTGGAAGG-3’ Human GAPDH reverse primer: 5’ – GCCATCACGCCACAGTTTC-3’ P. alecto ACTIN forward primer: 5’ – gccagtctacaccgtctgcag −3’ P. alecto ACTIN reverse primer: 5’ – cgtaggaatccttctggcccatg-3’ P. alecto MTHFD1 forward primer: 5’- gggagcgactgaagaaccaag-3’ P. alecto MTHFD1 reverse primer: 5’- tcttcagcagccttcagcttcac-3’ P. alecto SEC23B forward primer: 5’- cagcgtttgaccaggaggcc-3’ P. alecto SEC23B reverse primer: 5’- gggtcagatcctgtcgggc −3’ P. alecto GAPDH forward primer: 5’- ATACTTCTCATGGTTCACAC −3’ P. alecto GAPDH reverse primer: 5’ – TCATTGACCTCAACTACATG-3’ P. alecto ATP6V0D1 forward primer: 5’ – GTGGTAGAGTTCCGCCACAT-3’ P. alecto ATP6V0D1 reverse primer: 5’ – CTCAAAGCTGCCTAGTGGGT-3’ PR8 M1 forward primer: 5’ – TTCTAACCGAGGTCGAAACGTACG-3’ PR8 M1 reserve primer: 5’- ACAAAGCGTCTACGCTGCAG-3’ PR8 vRNA reserve transcription primer: 5’-AGCRAAAGCAGG-3’ ZIKV NS5 forward primer: 5’- GGTCAGCGTCCTCTCTAATAAACG-3’ ZIKV NS5 reserve primer: 5’- GCACCCTAGTGTCCACTTTTTCC-3’ Immunofluorescence: Virus infected cells were fixed with 4% paraformaldehyde (PFA) for 10min at room temperature (RT), and permeated with 0.2% Triton X-100 for another 10min at RT, the cells were washed with PBS for 3 times and incubated with PR8 HA antibody or ZIKV E protein antibody for 2h at RT or 4 °C overnight, then washed with PBS for 3 times and incubated with second antibody AF488 (goat anti mouse).
    anti mouse).
    suggested: None
    Experimental Models: Cell Lines
    SentencesResources
    Cells and virus: PaKi, Vero and 293T cells were cultured in DMEM supplemented with 10% heat inactivated FBS.
    293T
    suggested: None
    Mumps virus was propagated in PaKi or Vero cells.
    Vero
    suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)
    Software and Algorithms
    SentencesResources
    Samtools4 (version 1.9) was used to process the alignment files to retain perfectly mapped reads only, and a custom-made Python script was used to count the reads mapped to each guide.
    Python
    suggested: (IPython, RRID:SCR_001658)
    The reads count of guide for each condition were then normalized using DEseq2.
    DEseq2
    suggested: (DESeq2, RRID:SCR_015687)
    The specificity was tested by BLAST (NCBI).
    BLAST
    suggested: (BLASTX, RRID:SCR_001653)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.

    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

    Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 22 and 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

    Results from rtransparent:
    • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

  3. Version published to 10.1101/2020.03.29.014209v1 on bioRxiv