Orthogonal genome-wide screens of bat cells identify MTHFD1 as a target of broad antiviral therapy
This article has been Reviewed by the following groups
Discuss this preprint
Start a discussion What are Sciety discussions?Listed in
- Evaluated articles (ScreenIT)
Abstract
We established a genome-wide CRISPR library and a genome-wide RNA interference library for a bat species and performed two genetic screens to uncover host factors of bat cells involved in virus infections. Although the viruses and methodologies used were different in the two screens, we identified one common protein, MTHFD1, as a broad-spectrum host factor. Further studies show that the MTHFD1 inhibitor, carolacton, can potently inhibit a variety of viruses, including SARS-CoV-2. We provide a resource for studying the functional genomics of bat biology.
Article activity feed
-
-
SciScore for 10.1101/2020.03.29.014209: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources The following antibodies were used in this study: anti-MTHFD1 (Proteintech, 10794-1-AP), anti-beta actin (Easybio, BE0022), anti PR8 M1 (Genetex, GTX125928-S), anti HA (H1N1) (Genetex, GTX117951-S) anti-MTHFD1suggested: (Proteintech Cat# 10794-1-AP, RRID:AB_2147391)GTX125928-Ssuggested: NoneH1N1suggested: NoneGTX117951-Ssuggested: None), anti-ZIKV NS1 (Genetex, GTX133307), anti flavivirus group antigen antibody (Millipore, MAB10216). anti-ZIKV NS1suggested: …SciScore for 10.1101/2020.03.29.014209: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources The following antibodies were used in this study: anti-MTHFD1 (Proteintech, 10794-1-AP), anti-beta actin (Easybio, BE0022), anti PR8 M1 (Genetex, GTX125928-S), anti HA (H1N1) (Genetex, GTX117951-S) anti-MTHFD1suggested: (Proteintech Cat# 10794-1-AP, RRID:AB_2147391)GTX125928-Ssuggested: NoneH1N1suggested: NoneGTX117951-Ssuggested: None), anti-ZIKV NS1 (Genetex, GTX133307), anti flavivirus group antigen antibody (Millipore, MAB10216). anti-ZIKV NS1suggested: Noneanti flavivirus group antigen antibodysuggested: NoneThe primers for target genes were as follows: Human GAPDH forward primer: 5’-ACAACTTTGGTATCGTGGAAGG-3’ Human GAPDH reverse primer: 5’ – GCCATCACGCCACAGTTTC-3’ P. alecto ACTIN forward primer: 5’ – gccagtctacaccgtctgcag −3’ P. alecto ACTIN reverse primer: 5’ – cgtaggaatccttctggcccatg-3’ P. alecto MTHFD1 forward primer: 5’- gggagcgactgaagaaccaag-3’ P. alecto MTHFD1 reverse primer: 5’- tcttcagcagccttcagcttcac-3’ P. alecto SEC23B forward primer: 5’- cagcgtttgaccaggaggcc-3’ P. alecto SEC23B reverse primer: 5’- gggtcagatcctgtcgggc −3’ P. alecto GAPDH forward primer: 5’- ATACTTCTCATGGTTCACAC −3’ P. alecto GAPDH reverse primer: 5’ – TCATTGACCTCAACTACATG-3’ P. alecto ATP6V0D1 forward primer: 5’ – GTGGTAGAGTTCCGCCACAT-3’ P. alecto ATP6V0D1 reverse primer: 5’ – CTCAAAGCTGCCTAGTGGGT-3’ PR8 M1 forward primer: 5’ – TTCTAACCGAGGTCGAAACGTACG-3’ PR8 M1 reserve primer: 5’- ACAAAGCGTCTACGCTGCAG-3’ PR8 vRNA reserve transcription primer: 5’-AGCRAAAGCAGG-3’ ZIKV NS5 forward primer: 5’- GGTCAGCGTCCTCTCTAATAAACG-3’ ZIKV NS5 reserve primer: 5’- GCACCCTAGTGTCCACTTTTTCC-3’ Immunofluorescence: Virus infected cells were fixed with 4% paraformaldehyde (PFA) for 10min at room temperature (RT), and permeated with 0.2% Triton X-100 for another 10min at RT, the cells were washed with PBS for 3 times and incubated with PR8 HA antibody or ZIKV E protein antibody for 2h at RT or 4 °C overnight, then washed with PBS for 3 times and incubated with second antibody AF488 (goat anti mouse). anti mouse).suggested: NoneExperimental Models: Cell Lines Sentences Resources Cells and virus: PaKi, Vero and 293T cells were cultured in DMEM supplemented with 10% heat inactivated FBS. 293Tsuggested: NoneMumps virus was propagated in PaKi or Vero cells. Verosuggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)Software and Algorithms Sentences Resources Samtools4 (version 1.9) was used to process the alignment files to retain perfectly mapped reads only, and a custom-made Python script was used to count the reads mapped to each guide. Pythonsuggested: (IPython, RRID:SCR_001658)The reads count of guide for each condition were then normalized using DEseq2. DEseq2suggested: (DESeq2, RRID:SCR_015687)The specificity was tested by BLAST (NCBI). BLASTsuggested: (BLASTX, RRID:SCR_001653)Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 22 and 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
-
