SARS-CoV-2 infection induces a pro-inflammatory cytokine response through cGAS-STING and NF-κB
This article has been Reviewed by the following groups
Listed in
- Evaluated articles (ScreenIT)
Abstract
SARS-CoV-2 is a novel virus that has rapidly spread, causing a global pandemic. In the majority of infected patients, SARS-CoV-2 leads to mild disease; however, in a significant proportion of infections, individuals develop severe symptoms that can lead to long-lasting lung damage or death. These severe cases are often associated with high levels of pro-inflammatory cytokines and low antiviral responses, which can cause systemic complications. Here, we have evaluated transcriptional and cytokine secretion profiles and detected a distinct upregulation of inflammatory cytokines in infected cell cultures and samples taken from infected patients. Building on these observations, we found a specific activation of NF-κB and a block of IRF3 nuclear translocation in SARS-CoV-2 infected cells. This NF-κB response was mediated by cGAS-STING activation and could be attenuated through several STING-targeting drugs. Our results show that SARS-CoV-2 directs a cGAS-STING mediated, NF-κB-driven inflammatory immune response in human epithelial cells that likely contributes to inflammatory responses seen in patients and could be therapeutically targeted to suppress severe disease symptoms.
Article activity feed
-
-
SciScore for 10.1101/2020.07.21.212639: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement All material was obtained after approval by the by the Ethics Committee of the Medical Faculty Heidelberg (number S-148/2020) medical ethics committee of the University of Heidelberg, written consent was obtained from all patients prior to analysis. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Antibodies Primary antibodies and specific dilutions used for western blot or immunofluorescence included: Mouse anti-dsRNA J2 (Scicons: 10010500, anti-dsRNAsuggested: (SCICONS Cat# 10010200, AB…SciScore for 10.1101/2020.07.21.212639: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement All material was obtained after approval by the by the Ethics Committee of the Medical Faculty Heidelberg (number S-148/2020) medical ethics committee of the University of Heidelberg, written consent was obtained from all patients prior to analysis. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Antibodies Primary antibodies and specific dilutions used for western blot or immunofluorescence included: Mouse anti-dsRNA J2 (Scicons: 10010500, anti-dsRNAsuggested: (SCICONS Cat# 10010200, AB_2651015)Rabbit anti-IRF3 (Cell Signaling Technology: 11904S, IF - 1:400); Mouse anti-P65/RELA (Santa Cruz: sc-8008, IF - 1:100); Rabbit anticGAS (Atlas Antibodies: HPA031700, IF – 1:100); Rabbit anti-STING (Atlas Antibodies: HPA038534, IF – anti-IRF3suggested: (Cell Signaling Technology Cat# 11904, AB_2722521)anti-P65/RELAsuggested: NoneanticGASsuggested: NoneAntibodiessuggested: (Atlas Antibodies Cat# HPA031700, AB_10601693)anti-STINGsuggested: NoneMouse anti-Actin (Sigma Aldrich: A5441, WB1:5000). anti-Actinsuggested: (LifeSpan Cat# LS-C63541-5000, AB_10639001)Secondary antibodies used for western blot included Goat anti–rabbit IgG-HRP (Sigma Aldrich A6154, 1:2000) anti–rabbit IgG-HRPsuggested: NoneSecondary antibodies for immunofluorescence included: Alexa Fluor 488 donkey anti-rabbit IgG (Thermofisher A-21206), anti-rabbit IgGsuggested: (Thermo Fisher Scientific Cat# A-21206, AB_2535792)Experimental Models: Cell Lines Sentences Resources A549 cells stably expressing ACE2 and the SARS-CoV-2 reporter construct were created by lentivirus transduction. A549suggested: NCI-DTP Cat# A549, CVCL_0023To produce lentivirus particles, HEK-293T cells were transfected with pCMVGag-Pol, pMD2-VSV-G (kind gifts from Didier Trono, EPFL, Lausanne, Switzerland) and a pWPI vector encoding the gene of interest. HEK-293Tsuggested: NonePoly(I:C) and herring DNA transfection For Calu-3 cell stimulation (Fig. 4a,b) cells were transfected with the indicated amount of poly(I:C) using lipofectamine 2000 reagent as per the manufacturer’s protocol. Calu-3suggested: BCRJ Cat# 0264, CVCL_0609Plaque assay and CPE assay 2.5E+06 VeroE6 cells were seeded into each well of a 24-well plate. VeroE6suggested: JCRB Cat# JCRB1819, CVCL_YQ49For cytopathic effect (CPE) assays, Calu-3 or A549-ACE2 cells were plated into 96 well plates. A549-ACE2suggested: NoneSoftware and Algorithms Sentences Resources Primers for qPCR were designed using Primer3 software and include: SARS-CoV-2-ORF1 fwrd-5’- GAGAGCCTTGTCCCTGGTTT -3’, rev-5’- AGTCTCCAAAGCCACGTACG -3’; IFIT1 fwrd-5’-GAAGCAGGCAATCACAGAAA-3’, rev-5’TGAAACCGACCATAGTGGAA-3’; IFIT3 fwrd-5’-GAACATGCTGACCAAGCAG-3’, rev-5’CAGTTGTGTCCACCCTTCC-3’; TNF fwrd-5’-TAGCCCATGTTGTAGCAAACCC-3’, rev-5’GGACCTGGGAGTAGATGAGGT-3’ GAPDH fwrd-5’-GAAGGTGAAGGTCGGAGTC-3’, rev- 5’-GAAGATGGTGATGGGATTTC-3’; HPRT fwrd-5’- CCTGGCGTCGTGATTAGTG -3’, rev5’- ACACCCTTTCCAAATCCTCAG -3’. Primer3suggested: (Primer3, SCR_003139)First, data was collected for all samples after Robust Multi-Array Average (RMA) quantile normalization with R using the function ‘normalize.quantiles’ from Bioconductor package "preprocessCore" for probe set equalization. Bioconductorsuggested: (Bioconductor, SCR_006442)limma version 3.40.6,66), to estimate base mean expression and differential expression for the contrast infected vs mock treatment. limmasuggested: (LIMMA, SCR_010943)Rabbit anti-IRF3 (Cell Signaling Technology: 11904S, IF - 1:400); Mouse anti-P65/RELA (Santa Cruz: sc-8008, IF - 1:100); Rabbit anticGAS (Atlas Antibodies: HPA031700, IF – 1:100); Rabbit anti-STING (Atlas Antibodies: HPA038534, IF – Cell Signaling Technologysuggested: (Cell Signaling Technology, SCR_004431)A ChemoCam Imager 3.2 (Intas Science Imaging Instruments GmbH, Göttingen, Germany) was used to visualize the signals that were quantified using the ImageJ (FiJi) software package. ImageJsuggested: (ImageJ, SCR_003070)FiJisuggested: (Fiji, SCR_002285)Standard curves and concentrations were calculated with the BioPlex Manager software using the 5-parameter logistic plot regression formula. BioPlexsuggested: (BioPlex, SCR_016144)Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap used on pages 39 and 43. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.
-
SciScore for 10.1101/2020.07.21.212639: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement All material was obtained after approval by the by the Ethics Committee of the Medical Faculty Heidelberg (number S-148/2020) medical ethics committee of the University of Heidelberg, written consent was obtained from all patients prior to analysis. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Antibodies Primary antibodies and specific dilutions used for western blot or immunofluorescence included: Mouse anti-dsRNA J2 (Scicons: 10010500, anti-dsRNAsuggested: (SCICONS Cat# 10010200, AB…SciScore for 10.1101/2020.07.21.212639: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement All material was obtained after approval by the by the Ethics Committee of the Medical Faculty Heidelberg (number S-148/2020) medical ethics committee of the University of Heidelberg, written consent was obtained from all patients prior to analysis. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Antibodies Primary antibodies and specific dilutions used for western blot or immunofluorescence included: Mouse anti-dsRNA J2 (Scicons: 10010500, anti-dsRNAsuggested: (SCICONS Cat# 10010200, AB_2651015)Rabbit anti-IRF3 (Cell Signaling Technology: 11904S, IF - 1:400); Mouse anti-P65/RELA (Santa Cruz: sc-8008, IF - 1:100); Rabbit anticGAS (Atlas Antibodies: HPA031700, IF – 1:100); Rabbit anti-STING (Atlas Antibodies: HPA038534, IF – anti-IRF3suggested: (Cell Signaling Technology Cat# 11904, AB_2722521)anti-P65/RELAsuggested: NoneanticGASsuggested: NoneAntibodiessuggested: (Atlas Antibodies Cat# HPA031700, AB_10601693)anti-STINGsuggested: NoneMouse anti-Actin (Sigma Aldrich: A5441, WB1:5000). anti-Actinsuggested: (LifeSpan Cat# LS-C63541-5000, AB_10639001)Secondary antibodies used for western blot included Goat anti–rabbit IgG-HRP (Sigma Aldrich A6154, 1:2000) anti–rabbit IgG-HRPsuggested: NoneSecondary antibodies for immunofluorescence included: Alexa Fluor 488 donkey anti-rabbit IgG (Thermofisher A-21206), anti-rabbit IgGsuggested: (Thermo Fisher Scientific Cat# A-21206, AB_2535792)Experimental Models: Cell Lines Sentences Resources A549 cells stably expressing ACE2 and the SARS-CoV-2 reporter construct were created by lentivirus transduction. A549suggested: NCI-DTP Cat# A549, CVCL_0023To produce lentivirus particles, HEK-293T cells were transfected with pCMVGag-Pol, pMD2-VSV-G (kind gifts from Didier Trono, EPFL, Lausanne, Switzerland) and a pWPI vector encoding the gene of interest. HEK-293Tsuggested: NonePoly(I:C) and herring DNA transfection For Calu-3 cell stimulation (Fig. 4a,b) cells were transfected with the indicated amount of poly(I:C) using lipofectamine 2000 reagent as per the manufacturer’s protocol. Calu-3suggested: BCRJ Cat# 0264, CVCL_0609Plaque assay and CPE assay 2.5E+06 VeroE6 cells were seeded into each well of a 24-well plate. VeroE6suggested: JCRB Cat# JCRB1819, CVCL_YQ49For cytopathic effect (CPE) assays, Calu-3 or A549-ACE2 cells were plated into 96 well plates. A549-ACE2suggested: NoneSoftware and Algorithms Sentences Resources Primers for qPCR were designed using Primer3 software and include: SARS-CoV-2-ORF1 fwrd-5’- GAGAGCCTTGTCCCTGGTTT -3’, rev-5’- AGTCTCCAAAGCCACGTACG -3’; IFIT1 fwrd-5’-GAAGCAGGCAATCACAGAAA-3’, rev-5’TGAAACCGACCATAGTGGAA-3’; IFIT3 fwrd-5’-GAACATGCTGACCAAGCAG-3’, rev-5’CAGTTGTGTCCACCCTTCC-3’; TNF fwrd-5’-TAGCCCATGTTGTAGCAAACCC-3’, rev-5’GGACCTGGGAGTAGATGAGGT-3’ GAPDH fwrd-5’-GAAGGTGAAGGTCGGAGTC-3’, rev- 5’-GAAGATGGTGATGGGATTTC-3’; HPRT fwrd-5’- CCTGGCGTCGTGATTAGTG -3’, rev5’- ACACCCTTTCCAAATCCTCAG -3’. Primer3suggested: (Primer3, SCR_003139)First, data was collected for all samples after Robust Multi-Array Average (RMA) quantile normalization with R using the function ‘normalize.quantiles’ from Bioconductor package "preprocessCore" for probe set equalization. Bioconductorsuggested: (Bioconductor, SCR_006442)limma version 3.40.6,66), to estimate base mean expression and differential expression for the contrast infected vs mock treatment. limmasuggested: (LIMMA, SCR_010943)Rabbit anti-IRF3 (Cell Signaling Technology: 11904S, IF - 1:400); Mouse anti-P65/RELA (Santa Cruz: sc-8008, IF - 1:100); Rabbit anticGAS (Atlas Antibodies: HPA031700, IF – 1:100); Rabbit anti-STING (Atlas Antibodies: HPA038534, IF – Cell Signaling Technologysuggested: (Cell Signaling Technology, SCR_004431)A ChemoCam Imager 3.2 (Intas Science Imaging Instruments GmbH, Göttingen, Germany) was used to visualize the signals that were quantified using the ImageJ (FiJi) software package. ImageJsuggested: (ImageJ, SCR_003070)FiJisuggested: (Fiji, SCR_002285)Standard curves and concentrations were calculated with the BioPlex Manager software using the 5-parameter logistic plot regression formula. BioPlexsuggested: (BioPlex, SCR_016144)Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap used on pages 39 and 43. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.
-
SciScore for 10.1101/2020.07.21.212639: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement All material was obtained after approval by the by the Ethics Committee of the Medical Faculty Heidelberg (number S-148/2020) medical ethics committee of the University of Heidelberg, written consent was obtained from all patients prior to analysis. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Antibodies Primary antibodies and specific dilutions used for western blot or immunofluorescence included: Mouse anti-dsRNA J2 (Scicons: 10010500, anti-dsRNAsuggest…SciScore for 10.1101/2020.07.21.212639: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement All material was obtained after approval by the by the Ethics Committee of the Medical Faculty Heidelberg (number S-148/2020) medical ethics committee of the University of Heidelberg, written consent was obtained from all patients prior to analysis. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Antibodies Primary antibodies and specific dilutions used for western blot or immunofluorescence included: Mouse anti-dsRNA J2 (Scicons: 10010500, anti-dsRNAsuggested: (SCICONS Cat# 10010200, AB_2651015)Rabbit anti-IRF3 (Cell Signaling Technology: 11904S, IF - 1:400); Mouse anti-P65/RELA (Santa Cruz: sc-8008, IF - 1:100); Rabbit anticGAS (Atlas Antibodies: HPA031700, IF – 1:100); Rabbit anti-STING (Atlas Antibodies: HPA038534, IF – anti-IRF3suggested: (Cell Signaling Technology Cat# 11904, AB_2722521)<div style="margin-bottom:8px"> <div><b>anti-P65/RELA</b></div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div><b>anticGAS</b></div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div><b>Antibodies</b></div> <div>suggested: (Atlas Antibodies Cat# HPA031700, <a href="https://scicrunch.org/resources/Any/search?q=AB_10601693">AB_10601693</a>)</div> </div> <div style="margin-bottom:8px"> <div><b>anti-STING</b></div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse anti-Actin (Sigma Aldrich: A5441, WB1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>anti-Actin</b></div> <div>suggested: (LifeSpan Cat# LS-C63541-5000, <a href="https://scicrunch.org/resources/Any/search?q=AB_10639001">AB_10639001</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies used for western blot included Goat anti–rabbit IgG-HRP (Sigma Aldrich A6154, 1:2000)</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>anti–rabbit IgG-HRP</b></div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies for immunofluorescence included: Alexa Fluor 488 donkey anti-rabbit IgG (Thermofisher A-21206),</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>anti-rabbit IgG</b></div> <div>suggested: (Thermo Fisher Scientific Cat# A-21206, <a href="https://scicrunch.org/resources/Any/search?q=AB_2535792">AB_2535792</a>)</div> </div> </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Experimental Models: Cell Lines</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Methods Cell lines and culture conditions and viruses A549 and Calu-3 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with Glutamax (Gibco),10</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>Calu-3</b></div> <div>suggested: BCRJ Cat# 0264, <a href="https://scicrunch.org/resources/Any/search?q=CVCL_0609">CVCL_0609</a></div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 cells stably expressing ACE2 and the SARS-CoV-2 reporter construct were created by lentivirus transduction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>A549</b></div> <div>suggested: NCI-DTP Cat# A549, <a href="https://scicrunch.org/resources/Any/search?q=CVCL_0023">CVCL_0023</a></div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce lentivirus particles, HEK-293T cells were transfected with pCMVGag-Pol, pMD2-VSV-G (kind gifts from Didier Trono, EPFL, Lausanne, Switzerland) and a pWPI vector encoding the gene of interest.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>HEK-293T</b></div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">virus stock production SARS-CoV-2 stocks were produced using VeroE6 cell line.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>VeroE6</b></div> <div>suggested: JCRB Cat# JCRB1819, <a href="https://scicrunch.org/resources/Any/search?q=CVCL_YQ49">CVCL_YQ49</a></div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For cytopathic effect (CPE) assays, Calu-3 or A549-ACE2 cells were plated into 96 well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>A549-ACE2</b></div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Software and Algorithms</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primers for qPCR were designed using Primer3 software and include: SARS-CoV-2-ORF1 fwrd-5’- GAGAGCCTTGTCCCTGGTTT -3’, rev-5’- AGTCTCCAAAGCCACGTACG -3’; IFIT1 fwrd-5’-GAAGCAGGCAATCACAGAAA-3’, rev-5’TGAAACCGACCATAGTGGAA-3’; IFIT3 fwrd-5’-GAACATGCTGACCAAGCAG-3’, rev-5’CAGTTGTGTCCACCCTTCC-3’; TNF fwrd-5’-TAGCCCATGTTGTAGCAAACCC-3’, rev-5’GGACCTGGGAGTAGATGAGGT-3’ GAPDH fwrd-5’-GAAGGTGAAGGTCGGAGTC-3’, rev- 5’-GAAGATGGTGATGGGATTTC-3’; HPRT fwrd-5’- CCTGGCGTCGTGATTAGTG -3’, rev5’- ACACCCTTTCCAAATCCTCAG -3’.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>Primer3</b></div> <div>suggested: (Primer3, <a href="https://scicrunch.org/resources/Any/search?q=SCR_003139">SCR_003139</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, data was collected for all samples after Robust Multi-Array Average (RMA) quantile normalization with R using the function ‘normalize.quantiles’ from Bioconductor package "preprocessCore" for probe set equalization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>Bioconductor</b></div> <div>suggested: (Bioconductor, <a href="https://scicrunch.org/resources/Any/search?q=SCR_006442">SCR_006442</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">limma version 3.40.6,66), to estimate base mean expression and differential expression for the contrast infected vs mock treatment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>limma</b></div> <div>suggested: (LIMMA, <a href="https://scicrunch.org/resources/Any/search?q=SCR_010943">SCR_010943</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit anti-IRF3 (Cell Signaling Technology: 11904S, IF - 1:400); Mouse anti-P65/RELA (Santa Cruz: sc-8008, IF - 1:100); Rabbit anticGAS (Atlas Antibodies: HPA031700, IF – 1:100); Rabbit anti-STING (Atlas Antibodies: HPA038534, IF –</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>Cell Signaling Technology</b></div> <div>suggested: (Cell Signaling Technology, <a href="https://scicrunch.org/resources/Any/search?q=SCR_004431">SCR_004431</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A ChemoCam Imager 3.2 (Intas Science Imaging Instruments GmbH, Göttingen, Germany) was used to visualize the signals that were quantified using the ImageJ (FiJi) software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>ImageJ</b></div> <div>suggested: (ImageJ, <a href="https://scicrunch.org/resources/Any/search?q=SCR_003070">SCR_003070</a>)</div> </div> <div style="margin-bottom:8px"> <div><b>FiJi</b></div> <div>suggested: (Fiji, <a href="https://scicrunch.org/resources/Any/search?q=SCR_002285">SCR_002285</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Standard curves and concentrations were calculated with the BioPlex Manager software using the 5-parameter logistic plot regression formula.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>BioPlex</b></div> <div>suggested: (BioPlex, <a href="https://scicrunch.org/resources/Any/search?q=SCR_016144">SCR_016144</a>)</div> </div> </td></tr></table> <hr><p><i>Results from OddPub</i>: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see <a href="http://blogs.nature.com/naturejobs/2017/06/19/ask-not-what-you-can-do-for-open-data-ask-what-open-data-can-do-for-you/">Nature blog</a>).</p><hr style="border-top: 1px solid #ccc;"><p><i>Results from LimitationRecognizer</i>: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.</p><hr style="border-top: 1px solid #ccc;"><p><i>Results from Barzooka</i>: We did not find any issues relating to the usage of bar graphs.</p><hr style="border-top: 1px solid #ccc;"><p><i>Results from JetFighter</i>: Please consider improving the rainbow (“jet”) colormap used on pages 39 and 43. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.</p><hr><p><b>About SciScore</b></p> <p>SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow <a href="https://docs.google.com/document/d/1fY0Uze8b4udlPGDLNfAXgFiXzxUeACLssA_lieKMqTI/edit">this link</a>. -
SciScore for 10.1101/2020.07.21.212639: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement All material was obtained after approval by the by the Ethics Committee of the Medical Faculty Heidelberg (number S-148/2020) medical ethics committee of the University of Heidelberg, written consent was obtained from all patients prior to analysis. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Antibodies Primary antibodies and specific dilutions used for western blot or immunofluorescence included: Mouse anti-dsRNA J2 (Scicons: 10010500, anti-dsRNAsuggest…SciScore for 10.1101/2020.07.21.212639: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement All material was obtained after approval by the by the Ethics Committee of the Medical Faculty Heidelberg (number S-148/2020) medical ethics committee of the University of Heidelberg, written consent was obtained from all patients prior to analysis. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Antibodies Primary antibodies and specific dilutions used for western blot or immunofluorescence included: Mouse anti-dsRNA J2 (Scicons: 10010500, anti-dsRNAsuggested: (SCICONS Cat# 10010200, AB_2651015)Rabbit anti-IRF3 (Cell Signaling Technology: 11904S, IF - 1:400); Mouse anti-P65/RELA (Santa Cruz: sc-8008, IF - 1:100); Rabbit anticGAS (Atlas Antibodies: HPA031700, IF – 1:100); Rabbit anti-STING (Atlas Antibodies: HPA038534, IF – anti-IRF3suggested: (Cell Signaling Technology Cat# 11904, AB_2722521)<div style="margin-bottom:8px"> <div><b>anti-P65/RELA</b></div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div><b>anticGAS</b></div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div><b>Antibodies</b></div> <div>suggested: (Atlas Antibodies Cat# HPA031700, <a href="https://scicrunch.org/resources/Any/search?q=AB_10601693">AB_10601693</a>)</div> </div> <div style="margin-bottom:8px"> <div><b>anti-STING</b></div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse anti-Actin (Sigma Aldrich: A5441, WB1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>anti-Actin</b></div> <div>suggested: (LifeSpan Cat# LS-C63541-5000, <a href="https://scicrunch.org/resources/Any/search?q=AB_10639001">AB_10639001</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies used for western blot included Goat anti–rabbit IgG-HRP (Sigma Aldrich A6154, 1:2000)</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>anti–rabbit IgG-HRP</b></div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies for immunofluorescence included: Alexa Fluor 488 donkey anti-rabbit IgG (Thermofisher A-21206),</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>anti-rabbit IgG</b></div> <div>suggested: (Thermo Fisher Scientific Cat# A-21206, <a href="https://scicrunch.org/resources/Any/search?q=AB_2535792">AB_2535792</a>)</div> </div> </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Experimental Models: Cell Lines</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce lentivirus particles, HEK-293T cells were transfected with pCMVGag-Pol, pMD2-VSV-G (kind gifts from Didier Trono, EPFL, Lausanne, Switzerland) and a pWPI vector encoding the gene of interest.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>HEK-293T</b></div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 cells were inoculated with the viral supernatant overnight and next day antibiotic selections were applied.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>A549</b></div> <div>suggested: NCI-DTP Cat# A549, <a href="https://scicrunch.org/resources/Any/search?q=CVCL_0023">CVCL_0023</a></div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Passage 4 virus stocks were produced by using 500 µl of the seed virus (passage 3) to infect 9E+06 VeroE6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>VeroE6</b></div> <div>suggested: JCRB Cat# JCRB1819, <a href="https://scicrunch.org/resources/Any/search?q=CVCL_YQ49">CVCL_YQ49</a></div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For cytopathic effect (CPE) assays, Calu-3 or A549-ACE2 cells were plated into 96 well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>Calu-3</b></div> <div>suggested: BCRJ Cat# 0264, <a href="https://scicrunch.org/resources/Any/search?q=CVCL_0609">CVCL_0609</a></div> </div> <div style="margin-bottom:8px"> <div><b>A549-ACE2</b></div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Software and Algorithms</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primers for qPCR were designed using Primer3 software and include: SARS-CoV-2-ORF1 fwrd-5’- GAGAGCCTTGTCCCTGGTTT -3’, rev-5’- AGTCTCCAAAGCCACGTACG -3’; IFIT1 fwrd-5’-GAAGCAGGCAATCACAGAAA-3’, rev-5’TGAAACCGACCATAGTGGAA-3’; IFIT3 fwrd-5’-GAACATGCTGACCAAGCAG-3’, rev-5’CAGTTGTGTCCACCCTTCC-3’; TNF fwrd-5’-TAGCCCATGTTGTAGCAAACCC-3’, rev-5’GGACCTGGGAGTAGATGAGGT-3’ GAPDH fwrd-5’-GAAGGTGAAGGTCGGAGTC-3’, rev- 5’-GAAGATGGTGATGGGATTTC-3’; HPRT fwrd-5’- CCTGGCGTCGTGATTAGTG -3’, rev5’- ACACCCTTTCCAAATCCTCAG -3’.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>Primer3</b></div> <div>suggested: (Primer3, <a href="https://scicrunch.org/resources/Any/search?q=SCR_003139">SCR_003139</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, data was collected for all samples after Robust Multi-Array Average (RMA) quantile normalization with R using the function ‘normalize.quantiles’ from Bioconductor package "preprocessCore" for probe set equalization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>Bioconductor</b></div> <div>suggested: (Bioconductor, <a href="https://scicrunch.org/resources/Any/search?q=SCR_006442">SCR_006442</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">limma version 3.40.6,66), to estimate base mean expression and differential expression for the contrast infected vs mock treatment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>limma</b></div> <div>suggested: (LIMMA, <a href="https://scicrunch.org/resources/Any/search?q=SCR_010943">SCR_010943</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit anti-IRF3 (Cell Signaling Technology: 11904S, IF - 1:400); Mouse anti-P65/RELA (Santa Cruz: sc-8008, IF - 1:100); Rabbit anticGAS (Atlas Antibodies: HPA031700, IF – 1:100); Rabbit anti-STING (Atlas Antibodies: HPA038534, IF –</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>Cell Signaling Technology</b></div> <div>suggested: (Cell Signaling Technology, <a href="https://scicrunch.org/resources/Any/search?q=SCR_004431">SCR_004431</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A ChemoCam Imager 3.2 (Intas Science Imaging Instruments GmbH, Göttingen, Germany) was used to visualize the signals that were quantified using the ImageJ (FiJi) software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>ImageJ</b></div> <div>suggested: (ImageJ, <a href="https://scicrunch.org/resources/Any/search?q=SCR_003070">SCR_003070</a>)</div> </div> <div style="margin-bottom:8px"> <div><b>FiJi</b></div> <div>suggested: (Fiji, <a href="https://scicrunch.org/resources/Any/search?q=SCR_002285">SCR_002285</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Standard curves and concentrations were calculated with the BioPlex Manager software using the 5-parameter logistic plot regression formula.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>BioPlex</b></div> <div>suggested: (BioPlex, <a href="https://scicrunch.org/resources/Any/search?q=SCR_016144">SCR_016144</a>)</div> </div> </td></tr></table> <hr><p><i>Results from OddPub</i>: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see <a href="http://blogs.nature.com/naturejobs/2017/06/19/ask-not-what-you-can-do-for-open-data-ask-what-open-data-can-do-for-you/">Nature blog</a>).</p><hr style="border-top: 1px solid #ccc;"><p><i>Results from LimitationRecognizer</i>: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.</p><hr style="border-top: 1px solid #ccc;"><p><i>Results from Barzooka</i>: We did not find any issues relating to the usage of bar graphs.</p><hr style="border-top: 1px solid #ccc;"><p><i>Results from JetFighter</i>: Please consider improving the rainbow (“jet”) colormap used on pages 39 and 43. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.</p><hr><p><b>About SciScore</b></p> <p>SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow <a href="https://docs.google.com/document/d/1fY0Uze8b4udlPGDLNfAXgFiXzxUeACLssA_lieKMqTI/edit">this link</a>. -
SciScore for 10.1101/2020.07.21.212639: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement IRB: All material was obtained after approval by the by the Ethics Committee of the Medical Faculty Heidelberg (number S-148/2020) medical ethics committee of the University of Heidelberg, written consent was obtained from all patients prior to analysis.
Consent: All material was obtained after approval by the medical ethics committee of the University of Heidelberg; written consent was obtained from all patients prior to analysis.Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources The barcode plot implementation was … SciScore for 10.1101/2020.07.21.212639: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement IRB: All material was obtained after approval by the by the Ethics Committee of the Medical Faculty Heidelberg (number S-148/2020) medical ethics committee of the University of Heidelberg, written consent was obtained from all patients prior to analysis.
Consent: All material was obtained after approval by the medical ethics committee of the University of Heidelberg; written consent was obtained from all patients prior to analysis.Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources The barcode plot implementation was inspired by Zhan et al.70. Antibodies: Primary antibodies and specific dilutions used for western blot or immunofluorescence included: Mouse anti-dsRNA J2 (Scicons: 10010500, anti-dsRNA J2suggested: (SCICONS Cat# 10010200, RRID:AB_2651015)Rabbit anti-IRF3 (Cell Signaling Technology: 11904S, IF - 1:400); Mouse anti-P65/RELA (Santa Cruz: sc-8008, IF – 1:100); Rabbit anticGAS (Atlas Antibodies: HPA031700, IF – 1:100); Rabbit anti-STING (Atlas Antibodies: HPA038534, IF – anti-IRF3suggested: (Cell Signaling Technology Cat# 11904, RRID:AB_2722521)anti-P65/RELAsuggested: NoneanticGASsuggested: NoneAntibodiessuggested: (Atlas Antibodies Cat# HPA031700, RRID:AB_10601693)anti-STINGsuggested: NoneMouse anti-Actin (Sigma Aldrich: A5441, WB-1:5000). anti-Actinsuggested: (LSBio (LifeSpan Cat# LS-C63541-5000, RRID:AB_10639001)Secondary antibodies used for western blot included Goat anti–rabbit IgG-HRP (Sigma Aldrich A6154, 1:2000) anti–rabbit IgG-HRPsuggested: NoneSecondary antibodies for immunofluorescence included: Alexa Fluor 488 donkey anti-rabbit IgG (Thermofisher A-21206), anti-rabbit IgGsuggested: (Thermo Fisher Scientific Cat# A-21206, RRID:AB_2535792)Experimental Models: Cell Lines Sentences Resources Cell lines and culture conditions and viruses: A549 and Calu-3 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with Glutamax (Gibco),10 A549suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)To produce lentivirus particles, HEK-293T cells were transfected with pCMV-Gag-Pol, pMD2-VSV-G (kind gifts from Didier Trono, EPFL, Lausanne, Switzerland) and a pWPI vector encoding the gene of interest. HEK-293Tsuggested: NoneSARS-CoV-2 virus stock production: SARS-CoV-2 stocks were produced using VeroE6 cell line. VeroE6suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)For cytopathic effect (CPE) assays, Calu-3 or A549-ACE2 cells were plated into 96 well plates. Calu-3suggested: NoneA549-ACE2suggested: NoneSoftware and Algorithms Sentences Resources Primers for qPCR were designed using Primer3 software and include: SARS-CoV-2-ORF1 fwrd-5’-GAGAGCCTTGTCCCTGGTTT-3’, rev-5’-AGTCTCCAAAGCCACGTACG-3’; IFIT1 fwrd-5’-GAAGCAGGCAATCACAGAAA-3’, rev-5’-TGAAACCGACCATAGTGGAA-3’; IFIT3 fwrd-5’-GAACATGCTGACCAAGCAG-3’, rev-5’-CAGTTGTGTCCACCCTTCC-3’; TNF fwrd-5’-TAGCCCATGTTGTAGCAAACCC-3’, rev-5’-GGACCTGGGAGTAGATGAGGT-3’ GAPDH fwrd-5’-GAAGGTGAAGGTCGGAGTC-3’, rev-5’-GAAGATGGTGATGGGATTTC-3’; HPRT fwrd-5’-CCTGGCGTCGTGATTAGTG-3’, rev-5’-ACACCCTTTCCAAATCCTCAG-3’. Primer3suggested: (Primer3, RRID:SCR_003139)First, data was collected for all samples after Robust Multi-Array Average (RMA) quantile normalization with R using the function ‘normalize.quantiles’ from Bioconductor package “preprocessCore” for probe set equalization. Bioconductorsuggested: (Bioconductor, RRID:SCR_006442)limma version 3.40.6,66), to estimate base mean expression and differential expression for the contrast infected vs mock treatment. limmasuggested: (LIMMA, RRID:SCR_010943)Rabbit anti-IRF3 (Cell Signaling Technology: 11904S, IF - 1:400); Mouse anti-P65/RELA (Santa Cruz: sc-8008, IF – 1:100); Rabbit anticGAS (Atlas Antibodies: HPA031700, IF – 1:100); Rabbit anti-STING (Atlas Antibodies: HPA038534, IF – Cell Signaling Technologysuggested: (Cell Signaling Technology, RRID:SCR_004431)A ChemoCam Imager 3.2 (Intas Science Imaging Instruments GmbH, Göttingen, Germany) was used to visualize the signals that were quantified using the ImageJ (FiJi) software package. ImageJsuggested: (ImageJ, RRID:SCR_003070)FiJisuggested: (Fiji, RRID:SCR_002285)Standard curves and concentrations were calculated with the Bio-Plex Manager software using the 5-parameter logistic plot regression formula. Bio-Plex Managersuggested: NoneResults from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 43 and 39. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
-
SciScore for 10.1101/2020.07.21.212639: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement All material was obtained after approval by the by the Ethics Committee of the Medical Faculty Heidelberg (number S-148/2020) medical ethics committee of the University of Heidelberg, written consent was obtained from all patients prior to analysis. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Antibodies Primary antibodies and specific dilutions used for western blot or immunofluorescence included: Mouse anti-dsRNA J2 (Scicons: 10010500, anti-dsRNAsuggested: …SciScore for 10.1101/2020.07.21.212639: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement All material was obtained after approval by the by the Ethics Committee of the Medical Faculty Heidelberg (number S-148/2020) medical ethics committee of the University of Heidelberg, written consent was obtained from all patients prior to analysis. Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Antibodies Primary antibodies and specific dilutions used for western blot or immunofluorescence included: Mouse anti-dsRNA J2 (Scicons: 10010500, anti-dsRNAsuggested: (SCICONS Cat# 10010200, AB_2651015)Rabbit anti-IRF3 (Cell Signaling Technology: 11904S, IF - 1:400); Mouse anti-P65/RELA (Santa Cruz: sc-8008, IF - 1:100); Rabbit anticGAS (Atlas Antibodies: HPA031700, IF – 1:100); Rabbit anti-STING (Atlas Antibodies: HPA038534, IF – anti-IRF3suggested: (Cell Signaling Technology Cat# 11904, AB_2722521)<div style="margin-bottom:8px"> <div><b>anti-P65/RELA</b></div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div><b>anticGAS</b></div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div><b>Antibodies</b></div> <div>suggested: (Atlas Antibodies Cat# HPA031700, <a href="https://scicrunch.org/resources/Any/search?q=AB_10601693">AB_10601693</a>)</div> </div> <div style="margin-bottom:8px"> <div><b>anti-STING</b></div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse anti-Actin (Sigma Aldrich: A5441, WB1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>anti-Actin</b></div> <div>suggested: (LifeSpan Cat# LS-C63541-5000, <a href="https://scicrunch.org/resources/Any/search?q=AB_10639001">AB_10639001</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies used for western blot included Goat anti–rabbit IgG-HRP (Sigma Aldrich A6154, 1:2000)</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>anti–rabbit IgG-HRP</b></div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies for immunofluorescence included: Alexa Fluor 488 donkey anti-rabbit IgG (Thermofisher A-21206),</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>anti-rabbit IgG</b></div> <div>suggested: (Thermo Fisher Scientific Cat# A-21206, <a href="https://scicrunch.org/resources/Any/search?q=AB_2535792">AB_2535792</a>)</div> </div> </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Experimental Models: Cell Lines</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The levels of viral RNA, production of infectious virus and virus spread were significantly higher in Calu-3 cells compared to A549ACE2 cells (Fig. 1d-e).</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>A549ACE2</b></div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 or A549-ACE2 cells were pretreated with serial dilutions of type I, II or III IFNs, for 6 h followed by infection with SARSCoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>A549-ACE2</b></div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We first looked at RNA receptors that have previously been described to recognize viral RNAs including RIG-I, MDA5 and TLR3 as well as IFN receptors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>MDA5</b></div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Methods Cell lines and culture conditions and viruses A549 and Calu-3 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with Glutamax (Gibco),10%</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>A549</b></div> <div>suggested: NCI-DTP Cat# A549, <a href="https://scicrunch.org/resources/Any/search?q=CVCL_0023">CVCL_0023</a></div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce lentivirus particles, HEK-293T cells were transfected with pCMVGag-Pol, pMD2-VSV-G (kind gifts from Didier Trono, EPFL, Lausanne, Switzerland) and a pWPI vector encoding the gene of interest.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>HEK-293T</b></div> <div>suggested: None</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Passage 4 virus stocks were produced by using 500 µl of the seed virus (passage 3) to infect 9E+06 VeroE6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>VeroE6</b></div> <div>suggested: JCRB Cat# JCRB1819, <a href="https://scicrunch.org/resources/Any/search?q=CVCL_YQ49">CVCL_YQ49</a></div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Poly(I:C) and herring DNA transfection For Calu-3 cell stimulation (Fig. 4a,b) cells were transfected with the indicated amount of poly(I:C) using lipofectamine 2000 reagent as per the manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>Calu-3</b></div> <div>suggested: BCRJ Cat# 0264, <a href="https://scicrunch.org/resources/Any/search?q=CVCL_0609">CVCL_0609</a></div> </div> </td></tr><tr><td style="min-width:100px;text-align:center; padding-top:4px;" colspan="2"><b>Software and Algorithms</b></td></tr><tr><td style="min-width:100px;text=align:center"><i>Sentences</i></td><td style="min-width:100px;text-align:center"><i>Resources</i></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primers for qPCR were designed using Primer3 software and include: SARS-CoV-2-ORF1 fwrd-5’- GAGAGCCTTGTCCCTGGTTT -3’, rev-5’- AGTCTCCAAAGCCACGTACG -3’; IFIT1 fwrd-5’-GAAGCAGGCAATCACAGAAA-3’, rev-5’TGAAACCGACCATAGTGGAA-3’; IFIT3 fwrd-5’-GAACATGCTGACCAAGCAG-3’, rev-5’CAGTTGTGTCCACCCTTCC-3’; TNF fwrd-5’-TAGCCCATGTTGTAGCAAACCC-3’, rev-5’GGACCTGGGAGTAGATGAGGT-3’ GAPDH fwrd-5’-GAAGGTGAAGGTCGGAGTC-3’, rev- 5’-GAAGATGGTGATGGGATTTC-3’; HPRT fwrd-5’- CCTGGCGTCGTGATTAGTG -3’, rev5’- ACACCCTTTCCAAATCCTCAG -3’.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>Primer3</b></div> <div>suggested: (Primer3, <a href="https://scicrunch.org/resources/Any/search?q=SCR_003139">SCR_003139</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, data was collected for all samples after Robust Multi-Array Average (RMA) quantile normalization with R using the function ‘normalize.quantiles’ from Bioconductor package "preprocessCore" for probe set equalization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>Bioconductor</b></div> <div>suggested: (Bioconductor, <a href="https://scicrunch.org/resources/Any/search?q=SCR_006442">SCR_006442</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">limma version 3.40.6,66), to estimate base mean expression and differential expression for the contrast infected vs mock treatment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>limma</b></div> <div>suggested: (LIMMA, <a href="https://scicrunch.org/resources/Any/search?q=SCR_010943">SCR_010943</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit anti-IRF3 (Cell Signaling Technology: 11904S, IF - 1:400); Mouse anti-P65/RELA (Santa Cruz: sc-8008, IF - 1:100); Rabbit anticGAS (Atlas Antibodies: HPA031700, IF – 1:100); Rabbit anti-STING (Atlas Antibodies: HPA038534, IF –</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>Cell Signaling Technology</b></div> <div>suggested: (Cell Signaling Technology, <a href="https://scicrunch.org/resources/Any/search?q=SCR_004431">SCR_004431</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A ChemoCam Imager 3.2 (Intas Science Imaging Instruments GmbH, Göttingen, Germany) was used to visualize the signals that were quantified using the ImageJ (FiJi) software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>ImageJ</b></div> <div>suggested: (ImageJ, <a href="https://scicrunch.org/resources/Any/search?q=SCR_003070">SCR_003070</a>)</div> </div> <div style="margin-bottom:8px"> <div><b>FiJi</b></div> <div>suggested: (Fiji, <a href="https://scicrunch.org/resources/Any/search?q=SCR_002285">SCR_002285</a>)</div> </div> </td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Standard curves and concentrations were calculated with the BioPlex Manager software using the 5-parameter logistic plot regression formula.</td><td style="min-width:100px;border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div><b>BioPlex</b></div> <div>suggested: (BioPlex, <a href="https://scicrunch.org/resources/Any/search?q=SCR_016144">SCR_016144</a>)</div> </div> </td></tr></table>Data from additional tools added to each annotation on a weekly basis.
About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.
-
