Mucosal administration of a live attenuated recombinant COVID-19 vaccine protects nonhuman primates from SARS-CoV-2
This article has been Reviewed by the following groups
Listed in
- Evaluated articles (ScreenIT)
Abstract
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the causative agent of the COVID-19 global pandemic. SARS-CoV-2 is an enveloped RNA virus that relies on its trimeric surface glycoprotein spike for entry into host cells. Here we describe the COVID-19 vaccine candidate MV-014-212, a live, attenuated, recombinant human respiratory syncytial virus expressing a chimeric SARS-CoV-2 spike as the only viral envelope protein. MV-014-212 was attenuated and immunogenic in African green monkeys (AGMs). One mucosal administration of MV-014-212 in AGMs protected against SARS-CoV-2 challenge, reducing by more than 200-fold the peak shedding of SARS-CoV-2 in the nose. MV-014-212 elicited mucosal immunoglobulin A in the nose and neutralizing antibodies in serum that exhibited cross-neutralization against virus variants of concern Alpha, Beta, and Delta. Intranasally delivered, live attenuated vaccines such as MV-014-212 entail low-cost manufacturing suitable for global deployment. MV-014-212 is currently in Phase 1 clinical trials as an intranasal COVID-19 vaccine.
Article activity feed
-
-
SciScore for 10.1101/2021.07.16.452733: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics Field Sample Permit: The animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the BIOQUAL Institutional Animal Care and Use Committee (IACUC).
IACUC: The animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the BIOQUAL Institutional Animal Care and Use Committee (IACUC).Sex as a biological variable One male and 3 females were assigned to the MV-014-212 and RSV groups. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources For MV-014-212 and MVK-014-212, we used … SciScore for 10.1101/2021.07.16.452733: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics Field Sample Permit: The animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the BIOQUAL Institutional Animal Care and Use Committee (IACUC).
IACUC: The animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the BIOQUAL Institutional Animal Care and Use Committee (IACUC).Sex as a biological variable One male and 3 females were assigned to the MV-014-212 and RSV groups. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources For MV-014-212 and MVK-014-212, we used Rabbit anti-SARS-CoV-2 spike polyclonal antibody (Sino Biological) and Goat anti-rabbit HRP-conjugated secondary antibody (Jackson ImmunoResearch). MVK-014-212suggested: Noneanti-SARS-CoV-2suggested: Noneanti-rabbitsuggested: NoneFor rA2-mKate2, the reagents used were Goat anti-RSV primary antibody (Millipore) and Donkey anti-goat HRP-conjugated secondary antibody (Jackson ImmunoResearch). anti-goatsuggested: NoneThe blots were stripped with Restore Western Blot Stripping Buffer (ThermoFisher, Carlsbad, CA) and reprobed with goat anti-RSV polyclonal antisera (Sigma-Aldrich, St. Louis, MO) and a monoclonal antibody specific for GAPDH (6C5) protein (ThermoFisher, Carlsbad, CA). anti-RSVsuggested: NoneGAPDHsuggested: NoneThe plate was washed 4 times with 250 μL PBST and 100 μL of HRP-conjugated goat anti-monkey IgG antibody (PA1-8463, Thermo Fisher, Waltham, MA) diluted in blocking solution was added to each well following the last wash step. anti-monkey IgGsuggested: (Thermo Fisher Scientific Cat# PA1-8463, RRID:AB_2196308)PA1-8463suggested: (Thermo Fisher Scientific Cat# PA1-8463, RRID:AB_2196308)To generate the IgA standard curve anti-human IgA capture antibodies Mab MT57 (MabTech) were absorbed on plates instead of spike antigen. anti-human IgAsuggested: (MABTECH Cat# 3860-4-1000, RRID:AB_10734770)The standard total IgA antibody assayed on each test plate was used to calculate the concentration of IgA antibodies against spike protein in the AGM samples expressed in the arbitrary units ELU/mL. IgAsuggested: NoneSpike-specific IgG1 and IgG2a ELISA: Serum samples from mice were collected on Day -21 and on Day 28 post vaccination to quantify the levels of SARS-CoV-2 spike-specific IgG1 and IgG2a antibodies by ELISA. Spike-specific IgG1suggested: NoneIgG2asuggested: NoneThen, 100 μL of HRP-conjugated goat-anti-mouse IgG1 (Thermo Fisher) or HRP-conjugated goat-anti-mouse IgG2a (Thermo Fisher) secondary antibodies diluted 1:32,000 and 1:1000, respectively, were added to each well and the plate was incubated at room temperature for 1 h. IgG1suggested: NoneExperimental Models: Cell Lines Sentences Resources Virus rescue and harvest: Vero cells were electroporated with the bacterial artificial chromosome (BAC) encoding MV-014-212 (or the reporter virus) together with helper plasmids based on the pCDNA3.1 vector encoding the RSV proteins N, P, M2-1 and L, and the T7 polymerase under the control of a CMV promoter (Hotard 2021). Verosuggested: NonePrimers / Probe sequences are shown below: SG-F: CGATCTTGTAGATCTGTTCCTCAAACGAAC SG-R: ATATTGCAGCAGTACGCACACACA FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ TCID50 assay to detect shedding of SARS-CoV-2 in BAL and NS of AGMs after challenge: Vero TMPRSS2 cells (obtained from Adrian Creanga, Vaccine Research Center-NIAID) were plated at 25,000 cells/well in DMEM + 10% FBS + Gentamicin and the cultures were incubated at 37°C, 5.0% CO2. Vero TMPRSS2suggested: NoneConfluent RCB1 cells grown in a clear-bottom black 96-well plate (Grenier) were infected with the serum-virus mixes and centrifuged (spinoculated) at 1,800 x g for 30 minutes at 20 °C. RCB1suggested: NoneStarting with a dilution of 1/25, serial 2-fold dilutions of heat-inactivated AGM sera were incubated with the pseudotyped viral particles (3 x 105 RLU/well) at 37°C for one hour after which the mixes were used to infect Vero E6 monolayers in white 96-well plates. Vero E6suggested: NoneExperimental Models: Organisms/Strains Sentences Resources Male and female K18-hACE2 Tg (strain #034860, B6.Cg-Tg[K18-ACE2]2Prlmn/J) mice were procured from The Jackson Laboratory (Bar Harbor, ME) and were approximately 8-10 weeks old at the time of vaccination. B6.Cg-Tg[K18-ACE2]2Prlmn/Jsuggested: RRID:IMSR_JAX:034860)Recombinant DNA Sentences Resources The kRSV-DB1-QUAD plasmid and spike insert were digested with the enzymes AatII and SalI (NEB) and ligated with T4 DNA ligase (NEB) overnight at 16 ℃. kRSV-DB1-QUADsuggested: NoneThe construction of the plasmid rA2-mkate (a.k.a. kRSV-A2) was described in Rostad 2016. rA2-mkatesuggested: NoneVirus rescue and harvest: Vero cells were electroporated with the bacterial artificial chromosome (BAC) encoding MV-014-212 (or the reporter virus) together with helper plasmids based on the pCDNA3.1 vector encoding the RSV proteins N, P, M2-1 and L, and the T7 polymerase under the control of a CMV promoter (Hotard 2021). pCDNA3.1suggested: RRID:Addgene_79663)Software and Algorithms Sentences Resources The sequence traces were assembled using Sequencher software and the assembly was manually confirmed. Sequenchersuggested: (Sequencher, RRID:SCR_001528)The resulting curves of inhibition vs. dilution of the sera were fitted using non-linear regression, option “[inhibitor] vs normalized response-variable slope” in GraphPad Prism (version 9.0.0). GraphPad Prismsuggested: (GraphPad Prism, RRID:SCR_002798)Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The use of a semi permissive animal model for the evaluation of the live attenuated vaccine (LAV) candidate MV-014-212 constitutes a limitation of this study, since LAVs rely on replication to elicit a robust immune response. The semi-permissivity of AGMs to RSV and SARS-CoV-2 would result in lower replication of MV-014-212 and a more modest serum neutralizing antibody response. In a more permissive host like humans, MV-014-212 is expected to replicate to higher titers potentially resulting in higher immunogenicity than that observed in AGMs. Remarkably, immunization of AGM with MV-014-212 resulted in both mucosal and systemic antibody responses. There was approximately 100-fold more spike-specific total serum IgG in MV-014-212 vaccinated AGM compared to AGM that received wt RSV A2 or PBS inoculations. Spike-specific IgA was also detected in nasal swabs of MV-014-212 immunized animals. There was approximately an 8-fold increase in IgA concentration 25 days following vaccination with MV-014-212. In an experimental human challenge study, low RSV F-specific mucosal IgA was a better predictor for susceptibility to RSV challenge in seropositive adults than serum IgG and neutralizing antibody levels (Habibi 2015). Indeed, spike RBD-specific dimeric serum IgA was shown to be more potent at neutralizing SARS-CoV-2 than monomeric IgG (Wang 2021). By inference, secretory IgA which exists at mucosal surfaces as dimeric IgA may act as a potent inhibitor of SARS-CoV-2 at the site of infec...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:
Identifier Status Title NCT04798001 Recruiting Safety and Immunogenicity of an Intranasal RSV Vaccine Expre… Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
-
