Resilience of S309 and AZD7442 monoclonal antibody treatments against infection by SARS-CoV-2 Omicron lineage strains
This article has been Reviewed by the following groups
Listed in
- Evaluated articles (ScreenIT)
Abstract
Omicron variant strains encode large numbers of changes in the spike protein compared to historical SARS-CoV-2 isolates. Although in vitro studies have suggested that several monoclonal antibody therapies lose neutralizing activity against Omicron variants, the effects in vivo remain largely unknown. Here, we report on the protective efficacy against three SARS-CoV-2 Omicron lineage strains (BA.1, BA.1.1, and BA.2) of two monoclonal antibody therapeutics (S309 [Vir Biotechnology] monotherapy and AZD7442 [AstraZeneca] combination), which correspond to ones used to treat or prevent SARS-CoV-2 infections in humans. Despite losses in neutralization potency in cell culture, S309 or AZD7442 treatments reduced BA.1, BA.1.1, and BA.2 lung infection in susceptible mice that express human ACE2 (K18-hACE2) in prophylactic and therapeutic settings. Correlation analyses between in vitro neutralizing activity and reductions in viral burden in K18-hACE2 or human FcγR transgenic mice suggest that S309 and AZD7442 have different mechanisms of protection against Omicron variants, with S309 utilizing Fc effector function interactions and AZD7442 acting principally by direct neutralization. Our data in mice demonstrate the resilience of S309 and AZD7442 mAbs against emerging SARS-CoV-2 variant strains and provide insight into the relationship between loss of antibody neutralization potency and retained protection in vivo.
Article activity feed
-
-
SciScore for 10.1101/2022.03.17.484787: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01).
Consent: Fc-mediated effector functions: Primary cells were collected from healthy human donors with informed consent and authorization via the Comitato Etico Canton Ticino (Switzerland)Sex as a biological variable For experiments with K18-hACE2 mice, eight- to ten-week-old female mice were administered the indicated doses of the respective SARS-CoV-2 strains (see Figure legends) by intranasal administration. Randomization In vivo studies were not blinded, and mice were randomly assigned to treatment groups. Blinding In vivo studies were … SciScore for 10.1101/2022.03.17.484787: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01).
Consent: Fc-mediated effector functions: Primary cells were collected from healthy human donors with informed consent and authorization via the Comitato Etico Canton Ticino (Switzerland)Sex as a biological variable For experiments with K18-hACE2 mice, eight- to ten-week-old female mice were administered the indicated doses of the respective SARS-CoV-2 strains (see Figure legends) by intranasal administration. Randomization In vivo studies were not blinded, and mice were randomly assigned to treatment groups. Blinding In vivo studies were not blinded, and mice were randomly assigned to treatment groups. Power Analysis not detected. Cell Line Authentication Contamination: All cells routinely tested negative for mycoplasma using a PCR-based assay. Table 2: Resources
Antibodies Sentences Resources Monoclonal antibody purification: The mAbs studied in this paper, S309, AZD8895, AZD1061, and the AZD7442 cocktail have been described previously4,11,18. AZD8895suggested: NoneExperimental Models: Cell Lines Sentences Resources Cells: Vero-TMPRSS240 and Vero-hACE2-TMPRRS241 cells were cultured at 37°C in Dulbecco’s Modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 10□mM HEPES pH 7.3, □mM sodium pyruvate, 1× non-essential amino acids, and 100□U/ml of penicillin–streptomycin. Vero-hACE2-TMPRRS241suggested: NoneVero-hACE2-TMPRSS2 cells were supplemented with 10 µg/mL of puromycin. Vero-hACE2-TMPRSS2suggested: NoneAll virus stocks were generated in Vero-TMPRSS2 cells and subjected to next-generation sequencing as described previously41 to confirm the presence and stability of expected substitutions (see Supplementary Table 1). Vero-TMPRSS2suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)Viral plaque assay: Vero-TMPRSS2-hACE2 cells were seeded at a density of 1×105 cells per well in 24-well tissue culture plates. Vero-TMPRSS2-hACE2suggested: NoneExperimental Models: Organisms/Strains Sentences Resources Heterozygous K18-hACE2 C57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) and wild-type C57BL/6J (strain: 000664) mice were obtained from The Jackson Laboratory. C57BL/6Jsuggested: RRID:IMSR_JAX:000664)Human FcγR transgenic mice20 (FcγR -/- /hFcγRI+/hFcγRIIAR131+/hFcγRIIB+/hFcγRIIIAF158+/hFcγRIIIB+) were a generous gift (J. Ravetch, Rockefeller University) and bred at Washington University. FcγR -/- /hFcγRI+/hFcγRIIAR131+/hFcγRIIB+/hFcγRIIIAF158+/hFcγRIIIB+suggested: NoneRecombinant DNA Sentences Resources The following day, cells were transfected with SARS-CoV-2 spike glycoprotein-encoding pcDNA3.1(+) plasmids (BetaCoV/Wuhan-Hu-1/2019, accession number MN908947, Wuhan D614; Omicron BA.1 and BA.2 generated by overlap PCR mutagenesis of the Wuhan D614 plasmid) harboring the △19 C-terminal truncation26. pcDNA3.1 ( + )suggested: NoneSoftware and Algorithms Sentences Resources Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56- FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/). GACTGCCGCCTCTGCTCsuggested: NoneProbesuggested: (UniPROBE, RRID:SCR_005803)Data were analyzed using FlowJo software. FlowJosuggested: (FlowJo, RRID:SCR_008520)Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations of study: We note several limitations of our study: (a) Female K18-hACE2 mice were used to allow for group caging. Follow-up experiments in male mice to confirm and extend these results are needed. (b) The BA.1, BA.1.1., and BA.2 viruses are less pathogenic in mice than the D614G virus16,33-35. This could lead to an overestimation of protection compared to other more virulent strains in mice. (c) We only evaluated the efficacy of S309 or AZD7442 as prophylaxis. Whereas AZD7442 is authorized only as preventive agent, post-exposure therapeutic studies with both mAbs and Omicron variants may provide further insight as to effects on potency. Moreover, the relationship between initial viral dosing and antibody protection against Omicron variants was not explored. (d) Several experiments were performed in transgenic mice that over-express human ACE2 receptors. High levels of cellular hACE2 can diminish the neutralizing activity of mAbs that bind non-RBM sites of the SARS-CoV-2 spike36,37. Thus, studies in hACE2-transgenic mice could underestimate the efficacy of mAbs binding outside of the RBM. Challenge studies in other animal models and ultimately humans will be required for corroboration, including the contribution of Fc effector functions to mAb efficacy. Collectively, our data expand on recent in vitro findings with BA.1 strains by evaluating the level of protection conferred by treatment with two EUA mAbs against the three currently dominant Omicron variants. Whil...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
-
