mRNA-1273 and Ad26.COV2.S vaccines protect against the B.1.621 variant of SARS-CoV-2
This article has been Reviewed by the following groups
Listed in
- Evaluated articles (ScreenIT)
Abstract
No abstract available
Article activity feed
-
-
SciScore for 10.1101/2021.12.29.474432: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics not detected. Sex as a biological variable not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Plates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 [40] anti-S protein antibodies and HRP-conjugated goat anti-mouse IgG (Sigma Cat # A8924) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin. SARS2-57suggested: NoneSARS2-71suggested: Noneanti-S proteinsuggested: Noneanti-mouse IgGsuggested: (Sigma-Aldrich Cat# A8924, RRID:AB_258426)Experimental Models: Cell Lines Sentences Reso… SciScore for 10.1101/2021.12.29.474432: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics not detected. Sex as a biological variable not detected. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Plates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 [40] anti-S protein antibodies and HRP-conjugated goat anti-mouse IgG (Sigma Cat # A8924) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin. SARS2-57suggested: NoneSARS2-71suggested: Noneanti-S proteinsuggested: Noneanti-mouse IgGsuggested: (Sigma-Aldrich Cat# A8924, RRID:AB_258426)Experimental Models: Cell Lines Sentences Resources Antibody-virus complexes were added to Vero-hTMPRSS2 cell monolayers in 96-well plates and incubated at 37°C for 1 h. Vero-hTMPRSS2suggested: NonePlates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 [40] anti-S protein antibodies and HRP-conjugated goat anti-mouse IgG (Sigma Cat # A8924) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin. SARS2-71suggested: NoneVirus titration assays: Plaque assays were performed on Vero-hACE2-hTRMPSS2 cells in 24-well plates. Vero-hACE2-hTRMPSS2suggested: NoneSoftware and Algorithms Sentences Resources Four microliters RNA was used for real-time RT-qPCR to detect and quantify N gene of SARS-CoV-2 using TaqMan™ RNA-to-CT 1-Step Kit (Thermo Fisher Scientific) as described [41] using the following primers and probes: Forward: GACCCCAAAATCAGCGAAAT; Reverse: TCTGGTTACTGCCAGTTGAATCTG; Probe: ACCCCGCATTACGTTTGGTGGACC; 5’Dye/3’Quencher: 6-FAM/ZEN/IBFQ. GACCCCAAAATCAGCGAAATsuggested: NoneReversesuggested: NoneTCTGGTTACTGCCAGTTGAATCTGsuggested: NoneProbesuggested: (UniPROBE, RRID:SCR_005803)Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations of the study: We note several limitations of our study. (a) We did not evaluate the effects of the vaccine on the transmission of SARS-CoV-2 in Syrian hamsters, which may be an important measure of vaccine protection. (b) We used lower doses of vaccine to mimic suboptimal and possibly waning immunity. Studies that directly compare the quality of a waning immune response to that of a low dose vaccine induced immune response are needed. (c) The challenge dose of SARS-CoV-2 used in our hamster model (103 PFU) is several orders of magnitude higher that the minimal infectious dose (5 PFU) [34]. While this creates a very robust virus challenge model, it could underestimate the protective effects of vaccines. (d) We did not establish correlates of immune protection. We noted that lower serum antibody neutralization titers were associated with high viral loads and infectious virus titers in the Ad26.COV2.S immunized animals, as well as breakthrough infections in some of the mRNA-1273 vaccinated mice, albeit this did not explain all breakthrough infections. A more detailed analysis of T cell and non-neutralizing antibody responses coupled with even lower vaccine doses may be needed to fully establish a correlate of protection against breakthrough infection. Overall, our studies demonstrate that the Moderna mRNA-1273 and Johnson & Johnson Ad26.COV2.S vaccines authorized for emergency use are immunogenic in mice and Syrian hamsters and protect against the B.1.621 (Mu) varian...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
-
