Virus-Host Interactome and Proteomic Survey Reveal Potential Virulence Factors Influencing SARS-CoV-2 Pathogenesis
This article has been Reviewed by the following groups
Listed in
- Evaluated articles (ScreenIT)
Abstract
No abstract available
Article activity feed
-
-
SciScore for 10.1101/2020.03.31.019216: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement IRB: Ethics statement: This study was approved by the Ethics Committee of Shanghai Public Health Clinical Center (#YJ-2020-S052-02). Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Cell lines, plasmids, and antibodies: HEK293 and A549 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco-BRL) containing 4 mM glutamine and 10% FBS. antibodiessuggested: NoneHEK293suggested: NonePrimary antibodies were purchased from the following venters: mouse anti-Flag Purification of ZIKV viral protein complexes: … SciScore for 10.1101/2020.03.31.019216: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Institutional Review Board Statement IRB: Ethics statement: This study was approved by the Ethics Committee of Shanghai Public Health Clinical Center (#YJ-2020-S052-02). Randomization not detected. Blinding not detected. Power Analysis not detected. Sex as a biological variable not detected. Cell Line Authentication not detected. Table 2: Resources
Antibodies Sentences Resources Cell lines, plasmids, and antibodies: HEK293 and A549 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco-BRL) containing 4 mM glutamine and 10% FBS. antibodiessuggested: NoneHEK293suggested: NonePrimary antibodies were purchased from the following venters: mouse anti-Flag Purification of ZIKV viral protein complexes: HEK293 were transfected with 3xFlag-tagged plasmids encoding each SARS-CoV-2 protein by Lipofectamine 3000 (Thermo Fisher Scientific, #L3000015). anti-Flagsuggested: NoneExperimental Models: Cell Lines Sentences Resources Cell lines, plasmids, and antibodies: HEK293 and A549 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco-BRL) containing 4 mM glutamine and 10% FBS. A549suggested: NoneVero cells were cultured in DMEM with 5% FBS and 4 mM glutamine. Verosuggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)3×107 HEK293 cells were harvested in 10 ml lysis buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 0.5% Nonidet P40, 10% glycerol, phosphatase inhibitors and protease inhibitors) at 72 h post transfection, followed by centrifugation and filtration (0.45 μm) to remove debris. HEK293suggested: NoneSoftware and Algorithms Sentences Resources The acquired MS/MS data were analyzed against a UniProtKB Human database (database released on Sept. 30, 2018) containing SARS-CoV-2 viral proteins using Maxquant V1.6.10.43. UniProtKBsuggested: (UniProtKB, RRID:SCR_004426)Primer sequences for qPCR were as follow: IL-6 forward: AACCTGAACCTTCCAAAGATGG, IL-6 reverse: TCTGGCTTGTTCCTCACTACT; IL-8 forward: TCTTGCACAAATATTTGATGC, IL-8 reverse: CCACTGTGCCTTGGTTTC; GAPGH forward: GAGTCAACGGATTTGGTCGT, GAPGH reverse: TTGATTTTGGAGGGATCTCG; TNFα forward: CTCCAGGCGGTGCTTGTTC, TNFα reverse: GGCTACAGGCTTGTCACTCG; NKRF forward: GTAAACATGCAGCTGCCGAC, NKRF reverse: CGTGCACACGGGATTTGAAG. siRNA gene silencing: Small interfering RNA (siRNA) targeting human NKRF (#A10001) and negative control siRNAs were purchased from GenePharma. GenePharmasuggested: NoneResults from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
-