SARS-CoV-2 Infects Human Engineered Heart Tissues and Models COVID-19 Myocarditis

Article activity feed

1. Version published to 10.1016/j.jacbts.2021.01.002

   Apr 1, 2021
2. 

   ScreenIT

   Nov 6, 2020

   SciScore for 10.1101/2020.11.04.364315: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Institutional Review Board Statement	IRB: Human atrial tissue samples: The study protocol involving human tissue samples was approved by the ethics committees of the Medical Faculty of Heidelberg University (Germany; S-017/2013). Consent: Written informed consent was obtained from all patients and the study was conducted in accordance with the Declaration of Helsinki.
   Randomization	not detected.
   Blinding	not detected.
   Power Analysis	not detected.
   Sex as a biological variable	not detected.
   Cell Line Authentication	not detected.

   Table 2: Resources

   Antibodies
   Sentences	Resources
   Plates were incubated overnight at 4°C in 100 μL of permeabilization buffer containing 1 μg/mL of the CR3022 anti-spike monoclonal …

   SciScore for 10.1101/2020.11.04.364315: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Institutional Review Board Statement	IRB: Human atrial tissue samples: The study protocol involving human tissue samples was approved by the ethics committees of the Medical Faculty of Heidelberg University (Germany; S-017/2013). Consent: Written informed consent was obtained from all patients and the study was conducted in accordance with the Declaration of Helsinki.
   Randomization	not detected.
   Blinding	not detected.
   Power Analysis	not detected.
   Sex as a biological variable	not detected.
   Cell Line Authentication	not detected.

   Table 2: Resources

   Antibodies
   Sentences	Resources
   Plates were incubated overnight at 4°C in 100 μL of permeabilization buffer containing 1 μg/mL of the CR3022 anti-spike monoclonal antibody52.	CR3022 suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080) anti-spike suggested: None antibody52 suggested: None
   Following washing, 50 μL of goat anti-human secondary antibody conjugated to HRP (Sigma AP504P), diluted 1:1000 in permeabilization buffer, was added for 2 hours at room temperature with shaking.	goat anti-human secondary antibody suggested: None anti-human secondary suggested: None
   Arterial endothelium was identified as CD34+CD184+CD73+ cells using appropriate antibodies (BD Biosciences, anti-CD34 PE-Cy7 [cat # 560710], anti-CD184 APC [cat #560936], anti-CD73 PE [cat #550257]) and isolated by flow cytometric cell sorting on a BD FACSAriaII.	anti-CD34 suggested: (BD Biosciences Cat# 560710, RRID:AB_1727470) anti-CD184 APC suggested: None anti-CD73 PE suggested: (BD Biosciences Cat# 550257, RRID:AB_393561)
   , anti-CD45 FITC (cat #304006), and anti-CD31 BV421 (cat #303124) (all antibodies from Biolegend).	anti-CD45 FITC suggested: (BioLegend Cat# 304006, RRID:AB_314394) anti-CD31 BV421 suggested: (BioLegend Cat# 303124, RRID:AB_2563810)
   Primary antibodies (rabbit anti Troponin T, 1:400, Abcam, ab45932) were added for 1-2 hours at room temperature or overnight at 4 °C.	rabbit anti Troponin T suggested: None anti Troponin T suggested: None
   Cells were then washed with PBS before incubating for 1 hour in secondary antibody (Cy3 donkey anti-rabbit, Jackson Immunoresearch, 711165152). 4′,6-diamidino-2-phenylindole (DAPI) was used at a 1:50000 dilution to stain for nuclei.	Cy3 donkey anti-rabbit , Jackson Immunoresearch , 711165152) . 4′,6-diamidino-2-phenylindole suggested: None
   Primary antibodies against human sarcomeric actin (Sigma A2127), human Troponin T (ThermoFisher MS-295-P1), human CD68 (BioRad MCA5709)	human sarcomeric actin suggested: None human CD68 suggested: (Bio-Rad Cat# MCA5709, RRID:AB_11152768)
   Experimental Models: Cell Lines
   Sentences	Resources
   Infectious stocks were grown by inoculating Vero CCL81 cells and collecting supernatant upon observation of cytopathic effect.	Vero CCL81 suggested: None
   Focus forming assay: Vero E6 cells were seeded at a density of 4×104 cells per well in flat-bottom 96-well tissue culture plates.	Vero E6 suggested: None
   Software and Algorithms
   Sentences	Resources
   Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/).	GACTGCCGCCTCTGCTC suggested: None Probe suggested: (UniPROBE, RRID:SCR_005803)
   The DESeq2 package utilizes negative binominal distribution to model the distribution of RNA-Seq reads, and uses Wald test to calculate p-values54.	DESeq2 suggested: (DESeq, RRID:SCR_000154)
   Analysis was performed using FlowJo 10.6.1	FlowJo suggested: (FlowJo, RRID:SCR_008520)
   We wrote a custom script in MATLAB to calculate the displacement of the posts as a function of time.	MATLAB suggested: (MATLAB, RRID:SCR_001622)
   Images were collected on a confocal microscope (Zeiss LSM 700 Laser Scanning Confocal) and processed using ZenBlack (Zeiss) and ImageJ (NCBI).	ImageJ suggested: (ImageJ, RRID:SCR_003070)
   Basecalls and demultiplexing were performed with Illumina’s bcl2fastq software and a custom python demultiplexing program with a maximum of one mismatch in the indexing read.	Illumina’s suggested: None bcl2fastq suggested: (bcl2fastq , RRID:SCR_015058)
   RNA-seq reads were then aligned to the Human Ensembl GRCh38.76 primary assembly and SARS-CoV-2 NCBI NC_045512 Wuhan-Hu-1 genome with STAR version 2.5.1a63.	STAR suggested: (STAR, RRID:SCR_015899)
   Isoform expression of known Ensembl transcripts were estimated with Salmon version 0.8.265.	Salmon suggested: (Salmon, RRID:SCR_017036)
   The ribosomal fraction, known junction saturation, and read distribution over known gene models were quantified with RSeQC version 2.6.266.	RSeQC suggested: (RSeQC, RRID:SCR_005275)
   Perturbed KEGG pathways where the observed log 2 fold-changes of genes within the term were significantly perturbed in a single-direction versus background or in any direction compared to other genes within a given term with p-values less than or equal to 0.05 were rendered as nnotated KEGG graphs with the R/Bioconductor package Pathview72.	KEGG suggested: (KEGG, RRID:SCR_012773)
   To find the most critical genes, the raw counts were variance stabilized with the R/Bioconductor package DESeq254 and then analyzed via weighted gene correlation network analysis with the R/Bioconductor package WGCNA73.	R/Bioconductor suggested: None
   Significant terms with Benjamini-Hochberg adjusted p-values less than 0.05 were then collapsed by similarity into clusterProfiler category network plots to display the most significant terms for each module of hub genes in order to interpolate the function of each significant module.	clusterProfiler suggested: (clusterProfiler, RRID:SCR_016884)
   The information for all clustered genes for each module were combined with their respective statistical significance results from Limma to identify differentially expressed genes.	Limma suggested: (LIMMA, RRID:SCR_010943)
   Statistical significance was assigned when P values were < 0.05 using Prism Version 8 (GraphPad).	GraphPad suggested: (GraphPad Prism, RRID:SCR_002798)

   ---

   Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

   ---

   Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

   Despite these limitations, our findings clearly demonstrate that cardiomyocytes are a target of SARS-CoV-2 infection. Consistent with this conclusion, examination of human autopsy and endomyocardial biopsy tissue obtained from four patients with clinical diagnoses of COVID-19 myocarditis revealed evidence of myocardial SARS-CoV-2 RNA and protein predominately within cardiomyocytes and accumulation of macrophages in areas surrounding myocardial injury. These findings are consistent with prior reports highlighting infiltration of monocytes, lymphocytes, and plasma cells in an endomyocardial biopsy specimen from a patient with suspected COVID-19 myocarditis35 and viral RNA within the myocardium of COVID-19 autopsy specimens36. It is important to note that the human specimens examined in this study differ substantially from published autopsy series that did not include subjects with cardiac manifestations 3,37. Here, we exclusively focused on subjects with active COVID-19 infection and clinical evidence of myocarditis based on echocardiography and clinical presentation. Numerous studies have reported that extrapulmonary cell types are susceptible to SARS-CoV-2 infection38–40. This broader cellular tropism appears to be dictated by ACE2 expression and the ability of the virus to gain access to extrapulmonary tissues. Among cell types within the heart, cardiomyocytes and pericytes express ACE2 mRNA17. Our immunostaining studies of human heart samples and EHTs suggest that ACE2 prot...

   ---

   Results from TrialIdentifier: No clinical trial numbers were referenced.

   ---

   Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

   ---

   Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 49, 59, 61 and 57. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

   ---

   Results from rtransparent:

   • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
   • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
   • No protocol registration statement was detected.

   ---

   Read the original source
3. 

   Version published to 10.1101/2020.11.04.364315v1 on bioRxiv

   Nov 5, 2020