Inflammatory responses in the placenta upon SARS-CoV-2 infection late in pregnancy
This article has been Reviewed by the following groups
Listed in
- Evaluated articles (ScreenIT)
Abstract
No abstract available
Article activity feed
-
-
-
SciScore for 10.1101/2021.06.01.446676: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics not detected. Sex as a biological variable Placental Samples: Placental tissues from SARS-CoV-2 positive women and controls were obtained at delivery at Weill Cornell-NY Presbyterian by the Department of Pathology and Laboratory Medicine at Weill Cornell Medicine. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication not detected. Table 2: Resources
Experimental Models: Cell Lines Sentences Resources Vero E6 and A549 (adenocarcinomic human alveolar basal epithelial cell line)-ACE2 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 100 U/mL penicillin and 100 μg/mL streptomycin, and maintained … SciScore for 10.1101/2021.06.01.446676: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
Ethics not detected. Sex as a biological variable Placental Samples: Placental tissues from SARS-CoV-2 positive women and controls were obtained at delivery at Weill Cornell-NY Presbyterian by the Department of Pathology and Laboratory Medicine at Weill Cornell Medicine. Randomization not detected. Blinding not detected. Power Analysis not detected. Cell Line Authentication not detected. Table 2: Resources
Experimental Models: Cell Lines Sentences Resources Vero E6 and A549 (adenocarcinomic human alveolar basal epithelial cell line)-ACE2 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 100 U/mL penicillin and 100 μg/mL streptomycin, and maintained at 37°C with 5% CO2. A549suggested: Nonecellssuggested: NoneSARS-CoV-2 was propagated in Vero E6 cells in DMEM supplemented with 2% FBS, 4.5 g/L D-glucose, 4 mM L-glutamine, 10 mM Non-essential amino acids, 1 mM sodium pyruvate and 10 mM HEPES using a passage-2 stock of virus. Vero E6suggested: RRID:CVCL_XD71)Software and Algorithms Sentences Resources (https://www.atcc.org/). https://www.atcc.org/suggested: (ATCC, RRID:SCR_001672)SARS-CoV-2-N Forward 5’ CTCTTGTAGATCTGTTCTCTAAACGAAC 3’ Reverse 5’ GGTCCACCAAACGTAATGCG 3’ GAPDH Forward 5’ CATCACCATCTTCCAGGAGCGAGAT 3’ Reverse 5’ GAGGCATTGCTGATGATCTTGAGGC 3’ qRT-PCR graphs were generated using GraphPad Prism software. GraphPad Prismsuggested: (GraphPad Prism, RRID:SCR_002798)Clusters were washed once in MACS buffer, examined for viability with Trypan Blue (GIBCO) and plated onto Matrigel-coated 96-well dishes and μ-slide 8-well chamber slides (ibidi GmbH, Germany) at confluent density in DMEM/F12 supplemented with 10% FBS and penicillin/streptomycin/ fungizone, and were incubated at 37°C with 5% CO2 for 24 hours prior to infection with pseudovirus to allow for attachment, For infection with SARS-CoV-2, Sections of fresh chorionic villi (2g) were minced with sterile scalpels, digested in Accutase (Innovative Cell Technologies) for 7 min or isolated using a human umbilical cord dissociation kit (Millitenyi Biotec 130-105-737), and filtrated through a 100 μm cell strainer (Falcon) to obtain cell clusters of ∼50-100 cells. Millitenyi Biotecsuggested: NoneResults from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
-