A vaccine-induced public antibody protects against SARS-CoV-2 and emerging variants

Article activity feed

1. Version published to 10.1016/j.immuni.2021.08.013

   Sep 1, 2021
2. 

   ScreenIT

   Mar 27, 2021

   SciScore for 10.1101/2021.03.24.436864: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Institutional Review Board Statement	IACUC: SARS-CoV-2 hamster studies: All procedures involving animals were performed in accordance with guidelines of the Institutional Animal Care and Use Committee of Washington University in Saint Louis.
   Randomization	Animals were randomized from different litters into experimental groups and were acclimatized at the BSL3 facilities for 4-6 days prior to experiments.
   Blinding	not detected.
   Power Analysis	not detected.
   Sex as a biological variable	Four- to six-week old male Syrian hamsters were obtained from Charles River Laboratories and housed in an enhanced ABSL3 facility at Washington University in St Louis.
   Cell Line Authentication	not detected.

   Table 2: Resources

   …

   SciScore for 10.1101/2021.03.24.436864: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Institutional Review Board Statement	IACUC: SARS-CoV-2 hamster studies: All procedures involving animals were performed in accordance with guidelines of the Institutional Animal Care and Use Committee of Washington University in Saint Louis.
   Randomization	Animals were randomized from different litters into experimental groups and were acclimatized at the BSL3 facilities for 4-6 days prior to experiments.
   Blinding	not detected.
   Power Analysis	not detected.
   Sex as a biological variable	Four- to six-week old male Syrian hamsters were obtained from Charles River Laboratories and housed in an enhanced ABSL3 facility at Washington University in St Louis.
   Cell Line Authentication	not detected.

   Table 2: Resources

   Antibodies
   Sentences	Resources
   Plates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 anti-S antibodies (33) and HRP-conjugated goat anti-mouse IgG (Sigma 12-349) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin.	SARS2-57 suggested: None SARS2-71 suggested: None anti-S suggested: None anti-mouse IgG suggested: None
   Experimental Models: Cell Lines
   Sentences	Resources
   Cell lines: Expi293F cells were cultured in Expi293 Expression Medium (	Expi293F suggested: RRID:CVCL_D615)
   All viruses were passaged once in Vero-TMPRSS2 cells and subjected to deep sequencing after RNA extraction to confirm the introduction and stability of substitutions (16).	Vero-TMPRSS2 suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)
   Briefly, plaque assays were performed to isolate the VSV-SARS-CoV-2 escape mutant on Vero cells with mAb 2C08 in the overlay.	Vero suggested: None
   Software and Algorithms
   Sentences	Resources
   Area under the curve was calculated using Graphpad Prism v8.	Graphpad Prism suggested: (GraphPad Prism, RRID:SCR_002798)
   Four μL RNA was used for real-time qRT-PCR to detect and quantify N gene of SARS-CoV-2 using TaqMan™ Fast Virus 1-Step Master Mix as described (53) or using the following primers and probes: Forward: GACCCCAAAATCAGCGAAAT; Reverse: TCTGGTTACTGCCAGTTGAATCTG; Probe: ACCCCGCATTACGTTTGGTGGACC; 5’Dye/3’Quencher: 6-FAM/ZEN/IBFQ.	GACCCCAAAATCAGCGAAAT suggested: None Reverse suggested: None TCTGGTTACTGCCAGTTGAATCTG suggested: None Probe suggested: (UniPROBE, RRID:SCR_005803)

   ---

   Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

   ---

   Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

   ---

   Results from TrialIdentifier: No clinical trial numbers were referenced.

   ---

   Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

   ---

   Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 27. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

   ---

   Results from rtransparent:

   • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
   • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
   • No protocol registration statement was detected.

   ---

   Read the original source
3. 

   Version published to 10.1101/2021.03.24.436864 on bioRxiv

   Mar 25, 2021