A vaccine-induced public antibody protects against SARS-CoV-2 and emerging variants

This article has been Reviewed by the following groups

Read the full article See related articles

Discuss this preprint

Start a discussion What are Sciety discussions?

Abstract

No abstract available

Article activity feed

  1. SciScore for 10.1101/2021.03.24.436864: (What is this?)

    Please note, not all rigor criteria are appropriate for all manuscripts.

    Table 1: Rigor

    Institutional Review Board StatementIACUC: SARS-CoV-2 hamster studies: All procedures involving animals were performed in accordance with guidelines of the Institutional Animal Care and Use Committee of Washington University in Saint Louis.
    RandomizationAnimals were randomized from different litters into experimental groups and were acclimatized at the BSL3 facilities for 4-6 days prior to experiments.
    Blindingnot detected.
    Power Analysisnot detected.
    Sex as a biological variableFour- to six-week old male Syrian hamsters were obtained from Charles River Laboratories and housed in an enhanced ABSL3 facility at Washington University in St Louis.
    Cell Line Authenticationnot detected.

    Table 2: Resources

    Antibodies
    SentencesResources
    Plates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 anti-S antibodies (33) and HRP-conjugated goat anti-mouse IgG (Sigma 12-349) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin.
    SARS2-57
    suggested: None
    SARS2-71
    suggested: None
    anti-S
    suggested: None
    anti-mouse IgG
    suggested: None
    Experimental Models: Cell Lines
    SentencesResources
    Cell lines: Expi293F cells were cultured in Expi293 Expression Medium (
    Expi293F
    suggested: RRID:CVCL_D615)
    All viruses were passaged once in Vero-TMPRSS2 cells and subjected to deep sequencing after RNA extraction to confirm the introduction and stability of substitutions (16).
    Vero-TMPRSS2
    suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)
    Briefly, plaque assays were performed to isolate the VSV-SARS-CoV-2 escape mutant on Vero cells with mAb 2C08 in the overlay.
    Vero
    suggested: None
    Software and Algorithms
    SentencesResources
    Area under the curve was calculated using Graphpad Prism v8.
    Graphpad Prism
    suggested: (GraphPad Prism, RRID:SCR_002798)
    Four μL RNA was used for real-time qRT-PCR to detect and quantify N gene of SARS-CoV-2 using TaqMan™ Fast Virus 1-Step Master Mix as described (53) or using the following primers and probes: Forward: GACCCCAAAATCAGCGAAAT; Reverse: TCTGGTTACTGCCAGTTGAATCTG; Probe: ACCCCGCATTACGTTTGGTGGACC; 5’Dye/3’Quencher: 6-FAM/ZEN/IBFQ.
    GACCCCAAAATCAGCGAAAT
    suggested: None
    Reverse
    suggested: None
    TCTGGTTACTGCCAGTTGAATCTG
    suggested: None
    Probe
    suggested: (UniPROBE, RRID:SCR_005803)

    Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


    Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

    Results from TrialIdentifier: No clinical trial numbers were referenced.


    Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


    Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 27. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


    Results from rtransparent:
    • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
    • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
    • No protocol registration statement was detected.

    About SciScore

    SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.