Neutralizing and protective human monoclonal antibodies recognizing the N-terminal domain of the SARS-CoV-2 spike protein

Article activity feed

1. Version published to 10.1016/j.cell.2021.03.029

   Apr 1, 2021
2. 

   ScreenIT

   Jan 21, 2021

   SciScore for 10.1101/2021.01.19.427324: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Institutional Review Board Statement	not detected.
   Randomization	not detected.
   Blinding	not detected.
   Power Analysis	not detected.
   Sex as a biological variable	Protection against wild-type SARS-CoV-2 in mice: Male and female heterozygous K18-hACE C57BL/6J mice were housed in groups of up to 5 mice per cage at 18 to 24°C ambient temperatures and 40 to 60% humidity.
   Cell Line Authentication	not detected.

   Table 2: Resources

   Antibodies
   Sentences	Resources
   The bound antibodies were detected using goat anti-human IgG conjugated with horseradish peroxidase (HRP) (Southern Biotech, cat. 2040-05, lot B3919-XD29, 1:5,000 dilution) and a 3,3′,5,5′-tetramethylbenzidine (TMB) substrate (Thermo Fisher Scientific).	anti-human IgG

   SciScore for 10.1101/2021.01.19.427324: (What is this?)

   Please note, not all rigor criteria are appropriate for all manuscripts.

   Table 1: Rigor

   Institutional Review Board Statement	not detected.
   Randomization	not detected.
   Blinding	not detected.
   Power Analysis	not detected.
   Sex as a biological variable	Protection against wild-type SARS-CoV-2 in mice: Male and female heterozygous K18-hACE C57BL/6J mice were housed in groups of up to 5 mice per cage at 18 to 24°C ambient temperatures and 40 to 60% humidity.
   Cell Line Authentication	not detected.

   Table 2: Resources

   Antibodies
   Sentences	Resources
   The bound antibodies were detected using goat anti-human IgG conjugated with horseradish peroxidase (HRP) (Southern Biotech, cat. 2040-05, lot B3919-XD29, 1:5,000 dilution) and a 3,3′,5,5′-tetramethylbenzidine (TMB) substrate (Thermo Fisher Scientific).	anti-human IgG suggested: (SouthernBiotech Cat# 2040-05, RRID:AB_2795644)
   The plates were incubated sequentially with 1 μg/mL of rCR3022 anti-S antibody or an murine anti-SARS-COV-2 mAb, SARS2-16 (hybridoma supernatant diluted 1:6,000 to a final concentration of ∼20 ng/mL) and then HRP-conjugated goat anti-human IgG (Sigma-Aldrich, A6029) in PBS supplemented with 0.1% (w/v) saponin (Sigma) and 0.1% BSA.	anti-S suggested: None anti-SARS-COV-2 suggested: None
   Recombinant human ACE2 with a C-terminal Flag tag peptide was added to wells at 2 μg/mL in a 5 μL per well volume (final 0.4 μg/mL concentration of human ACE2) without washing of antibody and then incubated for 40 min at ambient temperature.	ACE2 suggested: None
   Plates were washed and bound human ACE2 was detected using HRP-conjugated anti-Flag antibody (Sigma-Aldrich, cat.	anti-Flag suggested: None
   To verify escape from antibody selection, isolated viruses were assessed in a subsequent RTCA experiment in the presence of 10 μg/mL (COV2-2676) and 100 µg/mL (COV2-2489) of mAb as used for the escape virus selection.	COV2-2676 suggested: None
   Experimental Models: Cell Lines
   Sentences	Resources
   A suspension of 18,000 Vero-E6 cells in 50 μL of cell culture medium was seeded in each well, and the plate was placed on the analyzer.	Vero-E6 suggested: None
   Triplicate wells containing virus only (maximal CPE in the absence of mAb) and wells containing only Vero cells in medium (no-CPE wells) were included as controls.	Vero suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)
   The mixture was added to pre-chilled Vero or Vero+ACE2+TMPRSS2 cells at an MOI of 0.005 and incubated at 4°C for 1 h.	Vero+ACE2+TMPRSS2 suggested: None
   A plasmid encoding cDNA for each spike protein mutant was transfected into HEK-293T cells and allowed to express for 22 h.	HEK-293T suggested: None
   A suspension of 18,000 Vero E6 cells in 50 μL of cell culture medium was seeded per each well, and plates were placed on the analyzer.	Vero E6 suggested: None
   Experimental Models: Organisms/Strains
   Sentences	Resources
   Protection against wild-type SARS-CoV-2 in mice: Male and female heterozygous K18-hACE C57BL/6J mice were housed in groups of up to 5 mice per cage at 18 to 24°C ambient temperatures and 40 to 60% humidity.	C57BL/6J suggested: None
   The samples were then analyzed by Eve Technologies Corporation (Calgary, AB, Canada).	AB suggested: RRID:BDSC_203)
   Software and Algorithms
   Sentences	Resources
   EC50 values for binding were determined using Prism v.	Prism suggested: (PRISM, RRID:SCR_005375)
   Briefly, 50 μL of cell culture medium (DMEM supplemented with 2% FBS) was added to each well of a 96-well E-plate using a ViaFlo384 liquid handler (Integra Biosciences) to obtain background reading.	Integra Biosciences suggested: None
   Image processing was performed using the cryoSPARC software package.	cryoSPARC suggested: (cryoSPARC, RRID:SCR_016501)
   Cells were washed twice and fixed with 4% PFA prior to detection of fluorescence signal by flow cytometry (MacsQuant) and analysis using FlowJo software.	FlowJo suggested: (FlowJo, RRID:SCR_008520)
   Specific primers and probe were used: Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/.	GACTGCCGCCTCTGCTC suggested: None
   For analysis of mouse studies, the comparison of weight-change curves was performed using a one-way ANOVA with Dunnett’s post hoc test using Prism v.9.0 (GraphPad).	GraphPad suggested: (GraphPad Prism, RRID:SCR_002798)

   ---

   Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

   ---

   Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

   ---

   Results from TrialIdentifier: No clinical trial numbers were referenced.

   ---

   Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

   ---

   Results from JetFighter: We did not find any issues relating to colormaps.

   ---

   Results from rtransparent:

   • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
   • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
   • No protocol registration statement was detected.

   ---

   Read the original source
3. 

   Version published to 10.1101/2021.01.19.427324v1 on bioRxiv

   Jan 20, 2021